Transcript: Human NM_001201473.2

Homo sapiens coronin 7 (CORO7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CORO7 (79585)
Length:
3217
CDS:
79..2601

Additional Resources:

NCBI RefSeq record:
NM_001201473.2
NBCI Gene record:
CORO7 (79585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001201473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220028 TGGCCTCATCCAGGATCTTTG pLKO.1 2942 3UTR 100% 10.800 7.560 N CORO7 n/a
2 TRCN0000220027 ACAAGCAGCTGCGGATCTTTG pLKO.1 389 CDS 100% 10.800 5.400 Y CORO7 n/a
3 TRCN0000155437 CGCATTGTCTGGGTATGTGAT pLKO.1 1879 CDS 100% 4.950 2.475 Y CORO7 n/a
4 TRCN0000155106 GAGTCCTGGATCAGTGACATT pLKO.1 136 CDS 100% 4.950 2.475 Y CORO7 n/a
5 TRCN0000436966 GCCACCAAGACCAGATCTTCA pLKO_005 1727 CDS 100% 4.950 2.475 Y CORO7 n/a
6 TRCN0000429646 ATGACCTCACTGTTCGCATCT pLKO_005 1667 CDS 100% 4.050 2.025 Y CORO7 n/a
7 TRCN0000156149 CGGAAAGAGTTCTTCCAGGAT pLKO.1 2278 CDS 100% 2.640 1.320 Y CORO7 n/a
8 TRCN0000436416 AGAAGGAGGAGCTGCTGAAAC pLKO_005 2498 CDS 100% 10.800 5.400 Y RPL35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04084 pDONR223 100% 90.8% 90.8% None 229_230ins255 n/a
2 ccsbBroad304_04084 pLX_304 0% 90.8% 90.8% V5 229_230ins255 n/a
3 TRCN0000468076 TGCCCGAAAGCATGAGTCCCTCTT pLX_317 15.3% 90.8% 90.8% V5 229_230ins255 n/a
Download CSV