Transcript: Human NM_001201529.3

Homo sapiens proprotein convertase subtilisin/kexin type 2 (PCSK2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PCSK2 (5126)
Length:
4586
CDS:
267..2078

Additional Resources:

NCBI RefSeq record:
NM_001201529.3
NBCI Gene record:
PCSK2 (5126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001201529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373136 ACCGGTCTTCACGAATCATTT pLKO_005 347 CDS 100% 13.200 18.480 N PCSK2 n/a
2 TRCN0000051750 CGGTACACAGATGACTGGTTT pLKO.1 756 CDS 100% 4.950 6.930 N PCSK2 n/a
3 TRCN0000051752 GCCATTCATGACAGACATCAT pLKO.1 890 CDS 100% 4.950 6.930 N PCSK2 n/a
4 TRCN0000051748 GCGAGGTTACAGAGACATCAA pLKO.1 485 CDS 100% 4.950 6.930 N PCSK2 n/a
5 TRCN0000051749 GCCTCCAACTATAATGCCGAA pLKO.1 693 CDS 100% 2.160 3.024 N PCSK2 n/a
6 TRCN0000373178 AGGAGACACTGTGCTATAAAT pLKO_005 2544 3UTR 100% 15.000 10.500 N PCSK2 n/a
7 TRCN0000373177 TGGATGATGGGATTGACTATC pLKO_005 658 CDS 100% 10.800 7.560 N PCSK2 n/a
8 TRCN0000221485 CCTGGAATTTAATCACCTCTT pLKO.1 1466 CDS 100% 4.050 2.835 N Pcsk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.