Transcript: Human NM_001202549.2

Homo sapiens SYNJ2BP-COX16 readthrough (SYNJ2BP-COX16), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-09
Taxon:
Homo sapiens (human)
Gene:
SYNJ2BP-COX16 (100529257)
Length:
1856
CDS:
128..604

Additional Resources:

NCBI RefSeq record:
NM_001202549.2
NBCI Gene record:
SYNJ2BP-COX16 (100529257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001202549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230608 ATATCTTTAGAGTCGGAATAT pLKO_005 464 CDS 100% 13.200 6.600 Y COX16 n/a
2 TRCN0000230610 GAAACTTGGATATGGGTAATT pLKO_005 711 3UTR 100% 13.200 6.600 Y COX16 n/a
3 TRCN0000230609 ACAACTTGACTCTGCTGATTC pLKO_005 596 CDS 100% 10.800 5.400 Y COX16 n/a
4 TRCN0000218893 AGAAATCCAGAAAGCCTTAAG pLKO_005 569 CDS 100% 10.800 5.400 Y COX16 n/a
5 TRCN0000121988 GCTGTAGACCTCTTTCGTAAT pLKO.1 368 CDS 100% 10.800 5.400 Y SYNJ2BP n/a
6 TRCN0000139049 CAGGAGGGTGATAAGATCCTT pLKO.1 305 CDS 100% 3.000 1.500 Y SYNJ2BP n/a
7 TRCN0000144682 GAAGAGATCAATCTTACCAGA pLKO.1 161 CDS 100% 2.640 1.320 Y SYNJ2BP n/a
8 TRCN0000172967 GAAAGGAAATTCCAGGCCCAT pLKO.1 689 3UTR 100% 2.160 1.080 Y COX16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001202549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08522 pDONR223 100% 75.4% 52.3% None (many diffs) n/a
2 ccsbBroad304_08522 pLX_304 0% 75.4% 52.3% V5 (many diffs) n/a
3 TRCN0000478302 CATATGCGTTCGCTCCAACCTGTC pLX_317 70.3% 75.4% 52.3% V5 (many diffs) n/a
Download CSV