Transcript: Human NM_001204126.2

Homo sapiens lymphoid restricted membrane protein (LRMP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
LRMP (4033)
Length:
2329
CDS:
555..2054

Additional Resources:

NCBI RefSeq record:
NM_001204126.2
NBCI Gene record:
LRMP (4033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204126.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419090 CAGTATCTGAACTTCGTAAAT pLKO_005 2096 3UTR 100% 13.200 18.480 N LRMP n/a
2 TRCN0000005913 CGTCCCTCATTACCTCGATTT pLKO.1 1632 CDS 100% 10.800 15.120 N LRMP n/a
3 TRCN0000005910 GCTGGGAAAGTATAGCATGAA pLKO.1 2129 3UTR 100% 4.950 6.930 N LRMP n/a
4 TRCN0000005911 CGGGTTAGTAAAGCAGTTGAA pLKO.1 1302 CDS 100% 4.950 3.960 N LRMP n/a
5 TRCN0000430155 GCCAAAGAGCACGCTGAATTA pLKO_005 1362 CDS 100% 13.200 9.240 N LRMP n/a
6 TRCN0000005914 CCAGAAACAATAGAAGAACAT pLKO.1 885 CDS 100% 4.950 3.465 N LRMP n/a
7 TRCN0000005912 CCTGGATTAGAAATTCTGAAT pLKO.1 693 CDS 100% 4.950 3.465 N LRMP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204126.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06537 pDONR223 100% 99.7% 99.3% None 421C>G;590G>C;1496_1497delTGinsC n/a
2 ccsbBroad304_06537 pLX_304 0% 99.7% 99.3% V5 (not translated due to frame shift) 421C>G;590G>C;1496_1497delTGinsC n/a
3 TRCN0000480072 CCGGTACGCTGTATCCTCGCTTTT pLX_317 25.6% 99.7% 99.3% V5 (not translated due to frame shift) 421C>G;590G>C;1496_1497delTGinsC n/a
Download CSV