Transcript: Human NM_001204267.2

Homo sapiens gamma-aminobutyric acid type A receptor alpha4 subunit (GABRA4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GABRA4 (2557)
Length:
10926
CDS:
147..1601

Additional Resources:

NCBI RefSeq record:
NM_001204267.2
NBCI Gene record:
GABRA4 (2557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061236 CATGGTTTATTGGGTTGTTTA pLKO.1 1538 CDS 100% 13.200 10.560 N GABRA4 n/a
2 TRCN0000061235 CCTTTGAAATTCGGGAGTTAT pLKO.1 648 CDS 100% 13.200 9.240 N GABRA4 n/a
3 TRCN0000061233 CCAGCTTAGTTCAATATGATT pLKO.1 745 CDS 100% 5.625 3.938 N GABRA4 n/a
4 TRCN0000061237 CGGGAGTTATGCCTATCCAAA pLKO.1 659 CDS 100% 4.950 3.465 N GABRA4 n/a
5 TRCN0000061234 CCTGATACTTTCTTCAGGAAT pLKO.1 477 CDS 100% 0.495 0.347 N GABRA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06240 pDONR223 100% 86% 85.7% None (many diffs) n/a
2 ccsbBroad304_06240 pLX_304 0% 86% 85.7% V5 (many diffs) n/a
3 TRCN0000480417 TAAGAATAGTCATTTCTTGTCCAC pLX_317 23.6% 86% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV