Transcript: Human NM_001204406.1

Homo sapiens arachidonate 5-lipoxygenase activating protein (ALOX5AP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
ALOX5AP (241)
Length:
1242
CDS:
249..905

Additional Resources:

NCBI RefSeq record:
NM_001204406.1
NBCI Gene record:
ALOX5AP (241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413713 ATGTCCGTTGCTGGCATATTC pLKO_005 792 CDS 100% 13.200 18.480 N ALOX5AP n/a
2 TRCN0000078151 CCCTGGCTACATATTTGGGAA pLKO.1 746 CDS 100% 2.640 2.112 N ALOX5AP n/a
3 TRCN0000078152 CTACATATTTGGGAAACGCAT pLKO.1 752 CDS 100% 2.640 2.112 N ALOX5AP n/a
4 TRCN0000427620 GGGCTTCACAGCTTGAGTTAA pLKO_005 1023 3UTR 100% 13.200 9.240 N ALOX5AP n/a
5 TRCN0000433249 GGGTTGGTGTTCTCATCTAAT pLKO_005 922 3UTR 100% 13.200 9.240 N ALOX5AP n/a
6 TRCN0000078149 GCTGGACTGATGTACTTGTTT pLKO.1 675 CDS 100% 5.625 3.938 N ALOX5AP n/a
7 TRCN0000078150 GCCAACCAGAACTGTGTAGAT pLKO.1 585 CDS 100% 4.950 3.465 N ALOX5AP n/a
8 TRCN0000078148 GCTCTTCTTTAGATGGCTGTA pLKO.1 986 3UTR 100% 4.050 2.835 N ALOX5AP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05804 pDONR223 100% 73.7% 73.8% None 1_171del;213C>T n/a
2 ccsbBroad304_05804 pLX_304 0% 73.7% 73.8% V5 1_171del;213C>T n/a
3 TRCN0000478230 ACCCGTTAACAAATATCATCATCT pLX_317 9.7% 73.7% 73.8% V5 1_171del;213C>T n/a
Download CSV