Construct: ORF TRCN0000478230
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017182.2_s317c1
- Derived from:
- ccsbBroadEn_05804
- DNA Barcode:
- ACCCGTTAACAAATATCATCATCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ALOX5AP (241)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478230
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 241 | ALOX5AP | arachidonate 5-lipoxygenase... | NM_001629.3 | 99.7% | 100% | 42C>T |
| 2 | human | 241 | ALOX5AP | arachidonate 5-lipoxygenase... | NM_001204406.1 | 73.7% | 73.8% | 1_171del;213C>T |
| 3 | human | 241 | ALOX5AP | arachidonate 5-lipoxygenase... | XM_017020522.2 | 71.8% | 66.4% | (many diffs) |
| 4 | mouse | 11690 | Alox5ap | arachidonate 5-lipoxygenase... | NM_009663.2 | 86.1% | 91.9% | (many diffs) |
| 5 | mouse | 11690 | Alox5ap | arachidonate 5-lipoxygenase... | NM_001308462.1 | 64.3% | 38.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 549
- ORF length:
- 483
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tcaagaaact gtaggcaatg ttgtcctgtt ggccattgtc accctcatca 121 gcgtggtcca gaatggattc tttgcccata aagtggagca cgaaagcagg acccagaatg 181 ggaggagctt ccagaggacc ggaacacttg cctttgagcg ggtctacact gccaaccaga 241 actgtgtaga tgcgtacccc actttcctcg ctgtgctctg gtctgcgggg ctactttgca 301 gccaagttcc tgctgcgttt gctggactga tgtacttgtt tgtgaggcaa aagtactttg 361 tcggttacct aggagagaga acgcagagca cccctggcta catatttggg aaacgcatca 421 tactcttcct gttcctcatg tccgttgctg gcatattcaa ctattacctc atcttctttt 481 tcggaagtga ctttgaaaac tacataaaga CGATCTCCAC CACCATCTCC CCTCTACTTC 541 TCATTCCCTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 601 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 661 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAACCCGT TAACAAATAT CATCATCTAC 721 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt