Transcript: Human NM_001204451.1

Homo sapiens cell cycle progression 1 (CCPG1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
CCPG1 (9236)
Length:
2571
CDS:
300..1574

Additional Resources:

NCBI RefSeq record:
NM_001204451.1
NBCI Gene record:
CCPG1 (9236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183068 CCACCTAAGTTAGAAGAAATT pLKO.1 630 CDS 100% 13.200 6.600 Y CCPG1 n/a
2 TRCN0000243125 TAGATAATGATGGAGTATTTG pLKO_005 1297 CDS 100% 13.200 6.600 Y CCPG1 n/a
3 TRCN0000243127 TGAATGATATGAAGGATTATC pLKO_005 1063 CDS 100% 13.200 6.600 Y CCPG1 n/a
4 TRCN0000243128 TACCCGAAGACAGTATCTATA pLKO_005 568 CDS 100% 0.000 0.000 Y CCPG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11352 pDONR223 100% 31.8% 26.5% None (many diffs) n/a
2 ccsbBroad304_11352 pLX_304 0% 31.8% 26.5% V5 (many diffs) n/a
3 TRCN0000479237 GCGTTTACATTCCGTCAGGGGGGG pLX_317 23.5% 31.8% 26.5% V5 (many diffs) n/a
Download CSV