Transcript: Human NM_001204477.2

Homo sapiens CMT1A duplicated region transcript 4 (CDRT4), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
CDRT4 (284040)
Length:
2508
CDS:
292..750

Additional Resources:

NCBI RefSeq record:
NM_001204477.2
NBCI Gene record:
CDRT4 (284040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158003 CCAGAACCCACACACTTACAT pLKO.1 637 CDS 100% 5.625 2.813 Y CDRT4 n/a
2 TRCN0000156342 CCAGAGACTGTCCAACTGAAA pLKO.1 665 CDS 100% 4.950 2.475 Y CDRT4 n/a
3 TRCN0000152612 GAATAAACCTTCCAGCGTCAT pLKO.1 492 CDS 100% 4.050 2.025 Y CDRT4 n/a
4 TRCN0000157503 GATTCCAGAGACTGTCCAACT pLKO.1 661 CDS 100% 4.050 2.025 Y CDRT4 n/a
5 TRCN0000152905 GCATCAAGGCAGAATAAACCT pLKO.1 481 CDS 100% 3.000 1.500 Y CDRT4 n/a
6 TRCN0000157969 CTATGATGAGGATGCTCCCTA pLKO.1 716 CDS 100% 2.640 1.320 Y CDRT4 n/a
7 TRCN0000157137 GCCTATGTCACCTATACCTCT pLKO.1 382 CDS 100% 2.640 1.320 Y CDRT4 n/a
8 TRCN0000158325 CAAGATCATCTTTGCCCGCAA pLKO.1 693 CDS 100% 2.160 1.080 Y CDRT4 n/a
9 TRCN0000156294 CGCTTATTCGGTATTGGCCAT pLKO.1 600 CDS 100% 2.160 1.080 Y CDRT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13511 pDONR223 100% 96.7% 96.7% None 1_15del n/a
2 ccsbBroad304_13511 pLX_304 0% 96.7% 96.7% V5 1_15del n/a
3 TRCN0000469393 CCAATATCAGGCCCAGGCCGGCGC pLX_317 77.8% 96.7% 96.7% V5 1_15del n/a
Download CSV