Transcript: Human NM_001204698.1

Homo sapiens Tax1 binding protein 3 (TAX1BP3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TAX1BP3 (30851)
Length:
1320
CDS:
154..450

Additional Resources:

NCBI RefSeq record:
NM_001204698.1
NBCI Gene record:
TAX1BP3 (30851)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160779 CGTGGTGCAAAGAGTTGAAAT pLKO.1 186 CDS 100% 13.200 9.240 N TAX1BP3 n/a
2 TRCN0000161638 GAATCCCTTCTCTGAAGACAA pLKO.1 282 CDS 100% 4.950 2.475 Y TAX1BP3 n/a
3 TRCN0000292287 GAATCCCTTCTCTGAAGACAA pLKO_005 282 CDS 100% 4.950 2.475 Y TAX1BP3 n/a
4 TRCN0000159034 GCAAAGAGTTGAAATTCACAA pLKO.1 192 CDS 100% 4.950 2.475 Y TAX1BP3 n/a
5 TRCN0000164205 CTCTGAAGACAAGACGGACAA pLKO.1 291 CDS 100% 4.050 2.025 Y TAX1BP3 n/a
6 TRCN0000161499 GTGAGAACTTAATCCTGGGTT pLKO.1 224 CDS 100% 2.640 1.320 Y TAX1BP3 n/a
7 TRCN0000162911 GTTTCAGCATTGGAGGTGGAA pLKO.1 242 CDS 100% 2.640 1.320 Y TAX1BP3 n/a
8 TRCN0000161210 GTTGAAATTCACAAGCTGCGT pLKO.1 199 CDS 100% 0.660 0.330 Y TAX1BP3 n/a
9 TRCN0000292322 GTTGAAATTCACAAGCTGCGT pLKO_005 199 CDS 100% 0.660 0.330 Y TAX1BP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08171 pDONR223 100% 78.7% 79% None 120T>C;157_158ins78 n/a
2 ccsbBroad304_08171 pLX_304 0% 78.7% 79% V5 120T>C;157_158ins78 n/a
3 TRCN0000467552 AATGGGCCTGAAGGCGCCGGAATT pLX_317 72.4% 78.7% 79% V5 120T>C;157_158ins78 n/a
Download CSV