Transcript: Mouse NM_001204979.1

Mus musculus seryl-aminoacyl-tRNA synthetase (Sars), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Sars (20226)
Length:
3632
CDS:
128..1666

Additional Resources:

NCBI RefSeq record:
NM_001204979.1
NBCI Gene record:
Sars (20226)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001204979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045583 CCTGTTCTAATTGCACGGATT pLKO.1 1308 CDS 100% 4.050 5.670 N SARS1 n/a
2 TRCN0000076150 CCATATGCTTAATGCTACAAT pLKO.1 1396 CDS 100% 0.000 0.000 N Sars n/a
3 TRCN0000325544 CCATATGCTTAATGCTACAAT pLKO_005 1396 CDS 100% 0.000 0.000 N Sars n/a
4 TRCN0000076151 GACAACAAAGTAGAACGTATT pLKO.1 581 CDS 100% 10.800 8.640 N Sars n/a
5 TRCN0000325613 GACAACAAAGTAGAACGTATT pLKO_005 581 CDS 100% 10.800 8.640 N Sars n/a
6 TRCN0000344764 CCTTACCACATTGTGAATATT pLKO_005 1199 CDS 100% 15.000 10.500 N SARS1 n/a
7 TRCN0000076152 CCCAGAGAACGTGCTGAATTT pLKO.1 367 CDS 100% 13.200 9.240 N Sars n/a
8 TRCN0000325614 CCCAGAGAACGTGCTGAATTT pLKO_005 367 CDS 100% 13.200 9.240 N Sars n/a
9 TRCN0000076148 CCAGACTTACTTACTAAGCCT pLKO.1 1673 3UTR 100% 0.750 0.525 N Sars n/a
10 TRCN0000325616 CCAGACTTACTTACTAAGCCT pLKO_005 1673 3UTR 100% 0.750 0.525 N Sars n/a
11 TRCN0000045587 CATCAGTTTGAGAAGATTGAA pLKO.1 1082 CDS 100% 5.625 3.938 N SARS1 n/a
12 TRCN0000333350 CATCAGTTTGAGAAGATTGAA pLKO_005 1082 CDS 100% 5.625 3.938 N SARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01481 pDONR223 100% 90.2% 95.5% None (many diffs) n/a
2 ccsbBroad304_01481 pLX_304 0% 90.2% 95.5% V5 (many diffs) n/a
3 TRCN0000465952 ACATTAGACTGTTTTTCCGTCAAT pLX_317 15.4% 90.2% 95.5% V5 (many diffs) n/a
4 ccsbBroadEn_06912 pDONR223 100% 90.2% 95.3% None (many diffs) n/a
5 ccsbBroad304_06912 pLX_304 0% 90.2% 95.3% V5 (many diffs) n/a
6 TRCN0000466129 GCGGCCCCGGAATTAGAATATCTA pLX_317 25% 90.2% 95.3% V5 (many diffs) n/a
Download CSV