Transcript: Mouse NM_001205044.1

Mus musculus jumonji, AT rich interactive domain 2 (Jarid2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Jarid2 (16468)
Length:
5670
CDS:
275..3979

Additional Resources:

NCBI RefSeq record:
NM_001205044.1
NBCI Gene record:
Jarid2 (16468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205044.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234444 TGCCCAACAGTATGGTATATT pLKO_005 780 CDS 100% 15.000 21.000 N Jarid2 n/a
2 TRCN0000362710 TGGTAACTGTTGAGGAATAAA pLKO_005 4290 3UTR 100% 15.000 21.000 N Jarid2 n/a
3 TRCN0000362781 CCCGCCAGCTACTCAAATTTC pLKO_005 688 CDS 100% 13.200 18.480 N Jarid2 n/a
4 TRCN0000234446 TGCGGAAAGGTGGACACTAAT pLKO_005 2861 CDS 100% 13.200 18.480 N Jarid2 n/a
5 TRCN0000096642 CCGCCATATAGCTAAGCCATT pLKO.1 3415 CDS 100% 4.050 5.670 N Jarid2 n/a
6 TRCN0000362715 GCCGAACCCATGGTCACTTAT pLKO_005 3984 3UTR 100% 13.200 10.560 N Jarid2 n/a
7 TRCN0000362714 CTCTACTAGCAACGATGTTAG pLKO_005 541 CDS 100% 10.800 8.640 N Jarid2 n/a
8 TRCN0000096641 GCTGCCCAACAGTATGGTATA pLKO.1 778 CDS 100% 10.800 8.640 N Jarid2 n/a
9 TRCN0000096643 GAACCCAAAGTCATGCACTAA pLKO.1 1513 CDS 100% 4.950 3.960 N Jarid2 n/a
10 TRCN0000234447 TGACTATTCCCTGGCTAAATA pLKO_005 3003 CDS 100% 15.000 10.500 N Jarid2 n/a
11 TRCN0000358750 TGACTATTCCCTGGCTAAATA pLKO_005 3003 CDS 100% 15.000 10.500 N JARID2 n/a
12 TRCN0000234445 ACTTCCACAAGTGCATCTATA pLKO_005 2694 CDS 100% 13.200 9.240 N Jarid2 n/a
13 TRCN0000358748 ACTTCCACAAGTGCATCTATA pLKO_005 2694 CDS 100% 13.200 9.240 N JARID2 n/a
14 TRCN0000096639 CCTGTCATCCATGTGCAATTT pLKO.1 4831 3UTR 100% 13.200 9.240 N Jarid2 n/a
15 TRCN0000234448 TGTCTTTGCACTAGCTCTAAA pLKO_005 4060 3UTR 100% 13.200 9.240 N Jarid2 n/a
16 TRCN0000362712 AGAAGTTGCTCTACCAGATTG pLKO_005 3444 CDS 100% 10.800 7.560 N Jarid2 n/a
17 TRCN0000368844 CAGATCCAGCACATCCATAAG pLKO_005 2096 CDS 100% 10.800 7.560 N Jarid2 n/a
18 TRCN0000362782 TTCCATATATTGACTACTTAC pLKO_005 3072 CDS 100% 10.800 7.560 N Jarid2 n/a
19 TRCN0000362780 TTGCTCAATCTCAGCCGAATA pLKO_005 624 CDS 100% 10.800 7.560 N Jarid2 n/a
20 TRCN0000096640 CCACCAACAATGCTTCATCTT pLKO.1 867 CDS 100% 4.950 3.465 N Jarid2 n/a
21 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4412 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205044.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.