Transcript: Human NM_001205220.1

Homo sapiens cysteine rich secretory protein 1 (CRISP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CRISP1 (167)
Length:
1903
CDS:
91..840

Additional Resources:

NCBI RefSeq record:
NM_001205220.1
NBCI Gene record:
CRISP1 (167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205220.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153432 CAACAAGGATCACCTCGATAT pLKO.1 577 CDS 100% 10.800 15.120 N CRISP1 n/a
2 TRCN0000153452 CCTGTATCATGGTCAAGTGTA pLKO.1 415 CDS 100% 4.950 6.930 N CRISP1 n/a
3 TRCN0000434097 ATCAGCTAGAGACCAATTTAA pLKO_005 162 CDS 100% 15.000 10.500 N CRISP1 n/a
4 TRCN0000150774 GCACAACTAACATCCAGTAAT pLKO.1 1211 3UTR 100% 13.200 9.240 N CRISP1 n/a
5 TRCN0000432074 GAAACAAAGAATGAACCTTAT pLKO_005 637 CDS 100% 10.800 7.560 N CRISP1 n/a
6 TRCN0000151263 CCAAGTAACTGTGAAGACAAA pLKO.1 685 CDS 100% 4.950 3.465 N CRISP1 n/a
7 TRCN0000156098 CCTTGAGAGGAGACTTCCAAA pLKO.1 357 CDS 100% 4.950 3.465 N CRISP1 n/a
8 TRCN0000153412 GCAAACAGAGTTCAGTCTCAT pLKO.1 1292 3UTR 100% 4.950 3.465 N CRISP1 n/a
9 TRCN0000155778 CCCATCCTGATACATCCTGAA pLKO.1 972 3UTR 100% 4.050 2.835 N CRISP1 n/a
10 TRCN0000154361 CTCAACAGTAACCTGGGCTAA pLKO.1 1119 3UTR 100% 4.050 2.835 N CRISP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205220.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.