Transcript: Human NM_001205254.2

Homo sapiens occludin (OCLN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
OCLN (100506658)
Length:
6181
CDS:
180..1748

Additional Resources:

NCBI RefSeq record:
NM_001205254.2
NBCI Gene record:
OCLN (100506658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205254.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159613 GATCTCTATATGGTTCACAAA pLKO.1 793 CDS 100% 4.950 6.930 N OCLN n/a
2 TRCN0000160698 CGAAGAAAGATGGACAGGTAT pLKO.1 981 CDS 100% 4.950 3.960 N OCLN n/a
3 TRCN0000158804 GCATAGGTGATCTCATTTAAT pLKO.1 2086 3UTR 100% 15.000 10.500 N OCLN n/a
4 TRCN0000158842 GCAAATGACTTTGGACCATAA pLKO.1 1811 3UTR 100% 10.800 7.560 N OCLN n/a
5 TRCN0000166691 CCTCTCAACCACCTTTCAGAT pLKO.1 2107 3UTR 100% 4.950 3.465 N OCLN n/a
6 TRCN0000120881 GCTCATTATTGTGATGTGCAT pLKO.1 389 CDS 100% 2.640 1.848 N Ocln n/a
7 TRCN0000159414 GCTCATTATTGTGATGTGCAT pLKO.1 389 CDS 100% 2.640 1.848 N OCLN n/a
8 TRCN0000158463 CAAGCAGTTAAAGAGCAAATT pLKO.1 1679 CDS 100% 13.200 7.920 N OCLN n/a
9 TRCN0000159771 GAATCATTGCAAGCAGTTAAA pLKO.1 1670 CDS 100% 13.200 6.600 Y OCLN n/a
10 TRCN0000158638 CTACAGGAATACAAGAGCTTA pLKO.1 1497 CDS 100% 4.950 2.475 Y OCLN n/a
11 TRCN0000159413 GAATTGGATGACTATAGAGAA pLKO.1 1566 CDS 100% 4.950 2.475 Y OCLN n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3268 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3268 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205254.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06667 pDONR223 100% 99.8% 99.8% None 96G>A;698T>C n/a
2 ccsbBroad304_06667 pLX_304 0% 99.8% 99.8% V5 96G>A;698T>C n/a
3 TRCN0000469640 GCATCCATCTACTCGCACACCTTC pLX_317 27.2% 99.8% 99.8% V5 96G>A;698T>C n/a
Download CSV