Transcript: Human NM_001205255.1

Homo sapiens occludin (OCLN), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
OCLN (100506658)
Length:
5404
CDS:
143..958

Additional Resources:

NCBI RefSeq record:
NM_001205255.1
NBCI Gene record:
OCLN (100506658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205255.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160698 CGAAGAAAGATGGACAGGTAT pLKO.1 191 CDS 100% 4.950 3.960 N OCLN n/a
2 TRCN0000158804 GCATAGGTGATCTCATTTAAT pLKO.1 1296 3UTR 100% 15.000 10.500 N OCLN n/a
3 TRCN0000158842 GCAAATGACTTTGGACCATAA pLKO.1 1021 3UTR 100% 10.800 7.560 N OCLN n/a
4 TRCN0000166691 CCTCTCAACCACCTTTCAGAT pLKO.1 1317 3UTR 100% 4.950 3.465 N OCLN n/a
5 TRCN0000158463 CAAGCAGTTAAAGAGCAAATT pLKO.1 889 CDS 100% 13.200 7.920 N OCLN n/a
6 TRCN0000159771 GAATCATTGCAAGCAGTTAAA pLKO.1 880 CDS 100% 13.200 6.600 Y OCLN n/a
7 TRCN0000158638 CTACAGGAATACAAGAGCTTA pLKO.1 707 CDS 100% 4.950 2.475 Y OCLN n/a
8 TRCN0000159413 GAATTGGATGACTATAGAGAA pLKO.1 776 CDS 100% 4.950 2.475 Y OCLN n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2478 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2478 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205255.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06667 pDONR223 100% 51.9% 51.9% None 0_1ins753 n/a
2 ccsbBroad304_06667 pLX_304 0% 51.9% 51.9% V5 0_1ins753 n/a
3 TRCN0000469640 GCATCCATCTACTCGCACACCTTC pLX_317 27.2% 51.9% 51.9% V5 0_1ins753 n/a
Download CSV