Transcript: Human NM_001206654.2

Homo sapiens nuclear receptor corepressor 2 (NCOR2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
NCOR2 (9612)
Length:
8971
CDS:
470..7984

Additional Resources:

NCBI RefSeq record:
NM_001206654.2
NBCI Gene record:
NCOR2 (9612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060705 GCTTCACAACACAGGCATGAA pLKO.1 6061 CDS 100% 4.950 3.960 N NCOR2 n/a
2 TRCN0000298965 GCTTCACAACACAGGCATGAA pLKO_005 6061 CDS 100% 4.950 3.960 N NCOR2 n/a
3 TRCN0000238142 GAAAGGCACTCATGGGTAAAT pLKO_005 7470 CDS 100% 13.200 9.240 N Ncor2 n/a
4 TRCN0000296045 GAAAGGCACTCATGGGTAAAT pLKO_005 7470 CDS 100% 13.200 9.240 N NCOR2 n/a
5 TRCN0000095279 CCTGTCTAAAGCCTTAACTAA pLKO.1 8143 3UTR 100% 5.625 3.938 N Ncor2 n/a
6 TRCN0000060703 GCCTGTCTAAAGCCTTAACTA pLKO.1 8142 3UTR 100% 5.625 3.938 N NCOR2 n/a
7 TRCN0000298963 GCCTGTCTAAAGCCTTAACTA pLKO_005 8142 3UTR 100% 5.625 3.938 N NCOR2 n/a
8 TRCN0000060704 CCTCTATTACTACCTGACTAA pLKO.1 1867 CDS 100% 4.950 3.465 N NCOR2 n/a
9 TRCN0000060706 GCAGCGCATCAAGTTCATCAA pLKO.1 1678 CDS 100% 4.950 3.465 N NCOR2 n/a
10 TRCN0000298964 GCAGCGCATCAAGTTCATCAA pLKO_005 1678 CDS 100% 4.950 3.465 N NCOR2 n/a
11 TRCN0000060707 GCAGTGTAAGAACTTCTACTT pLKO.1 2407 CDS 100% 4.950 3.465 N NCOR2 n/a
12 TRCN0000298889 GCAGTGTAAGAACTTCTACTT pLKO_005 2407 CDS 100% 4.950 3.465 N NCOR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.