Transcript: Human NM_001206855.2

Homo sapiens transferrin receptor 2 (TFR2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TFR2 (7036)
Length:
2468
CDS:
135..2027

Additional Resources:

NCBI RefSeq record:
NM_001206855.2
NBCI Gene record:
TFR2 (7036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206855.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063629 GCATGTACAACGTGCGCATAA pLKO.1 1732 CDS 100% 10.800 15.120 N TFR2 n/a
2 TRCN0000063628 GCCAGATCACTACGTTGTCAT pLKO.1 887 CDS 100% 4.950 6.930 N TFR2 n/a
3 TRCN0000063631 CTACCCATTCCTGCACACAAA pLKO.1 1400 CDS 100% 4.950 3.465 N TFR2 n/a
4 TRCN0000063632 CAACAACATCTTCGGCTGCAT pLKO.1 851 CDS 100% 2.640 1.848 N TFR2 n/a
5 TRCN0000063630 GCCGCTCTGACTCAGGACATT pLKO.1 138 CDS 100% 1.650 1.155 N TFR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206855.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07054 pDONR223 100% 78.6% 78.6% None 0_1ins513 n/a
2 ccsbBroad304_07054 pLX_304 0% 78.6% 78.6% V5 0_1ins513 n/a
3 TRCN0000467754 CCGCCCATCGTGCAGTATACTTAC pLX_317 17.4% 78.6% 78.6% V5 0_1ins513 n/a
4 ccsbBroadEn_07055 pDONR223 100% 78.6% 78.6% None 0_1ins513;678G>T n/a
5 ccsbBroad304_07055 pLX_304 0% 78.6% 78.6% V5 0_1ins513;678G>T n/a
6 TRCN0000476905 GCTGCGCTCTGACAAACGTCGTTG pLX_317 13.6% 78.6% 78.6% V5 0_1ins513;678G>T n/a
Download CSV