Transcript: Human NM_001207058.3

Homo sapiens integrator complex subunit 14 (INTS14), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
INTS14 (81556)
Length:
2116
CDS:
80..1486

Additional Resources:

NCBI RefSeq record:
NM_001207058.3
NBCI Gene record:
INTS14 (81556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207058.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263950 TATCATGTGCATGGCGAATTT pLKO_005 391 CDS 100% 13.200 18.480 N INTS14 n/a
2 TRCN0000168120 GAAGGAATGGTAGCGATTGTT pLKO.1 887 CDS 100% 5.625 7.875 N INTS14 n/a
3 TRCN0000282875 TCACCTCTTCCCTCGTTTATA pLKO_005 1836 3UTR 100% 15.000 12.000 N INTS14 n/a
4 TRCN0000263949 TTGAACGTCTCATAGATTTAA pLKO_005 447 CDS 100% 15.000 10.500 N INTS14 n/a
5 TRCN0000182917 CAAGAAGAAATCAAACCTCAT pLKO.1 955 CDS 100% 4.050 2.835 N 6330549D23Rik n/a
6 TRCN0000172785 GCTTGGAAGATAGCTGCTGTT pLKO.1 1706 3UTR 100% 4.050 2.835 N INTS14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207058.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09071 pDONR223 100% 90.2% 89.9% None (many diffs) n/a
2 ccsbBroad304_09071 pLX_304 0% 90.2% 89.9% V5 (many diffs) n/a
3 TRCN0000471372 CAAACGTAGTTTTACTCTATAGTT pLX_317 28.7% 90.2% 89.9% V5 (many diffs) n/a
Download CSV