Transcript: Human NM_001207072.2

Homo sapiens family with sequence similarity 181 member A (FAM181A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
FAM181A (90050)
Length:
1693
CDS:
371..1249

Additional Resources:

NCBI RefSeq record:
NM_001207072.2
NBCI Gene record:
FAM181A (90050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207072.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122465 GACCATAGGTACTGGGATGTT pLKO.1 1511 3UTR 100% 4.950 6.930 N FAM181A n/a
2 TRCN0000436333 GACCTCCCTATGAGGGTAAGA pLKO_005 855 CDS 100% 4.950 6.930 N FAM181A n/a
3 TRCN0000431897 CCCTACAGGGAGGAATGTCTT pLKO_005 677 CDS 100% 4.950 3.960 N FAM181A n/a
4 TRCN0000122882 GCCGCGTCAATGCCTGGAGTT pLKO.1 987 CDS 100% 0.000 0.000 N FAM181A n/a
5 TRCN0000419836 TCAAGGCAGCCCTGGATAAGT pLKO_005 432 CDS 100% 5.625 3.938 N FAM181A n/a
6 TRCN0000122492 CCCACCCATCTTCAATGTCTT pLKO.1 1216 CDS 100% 4.950 3.465 N FAM181A n/a
7 TRCN0000436763 AGACTACCCTGGTGTCCATGT pLKO_005 909 CDS 100% 4.050 2.835 N FAM181A n/a
8 TRCN0000147019 CATCTTCAATGTCTTTGGCTA pLKO.1 1222 CDS 100% 2.640 1.848 N FAM181A n/a
9 TRCN0000148516 CTTCAATGTCTTTGGCTACCT pLKO.1 1225 CDS 100% 2.640 1.848 N FAM181A n/a
10 TRCN0000413881 CGCTTCTCCCAGAAGTATTCC pLKO_005 509 CDS 100% 4.950 2.970 N FAM181A n/a
11 TRCN0000122284 CGACAGTGATGTGAAGATGCT pLKO.1 379 CDS 100% 2.640 1.584 N FAM181A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207072.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12930 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12930 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469649 AGGCTGACCTGAATCAGCGACTAA pLX_317 40.8% 100% 100% V5 n/a
Download CSV