Transcript: Human NM_001220767.2

Homo sapiens IKAROS family zinc finger 1 (IKZF1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
IKZF1 (10320)
Length:
5772
CDS:
15..1283

Additional Resources:

NCBI RefSeq record:
NM_001220767.2
NBCI Gene record:
IKZF1 (10320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001220767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236421 TATTGTGGCCGAAGCTATAAA pLKO_005 366 CDS 100% 15.000 21.000 N IKZF1 n/a
2 TRCN0000236419 CCGCTTCCACATGAGCTAAAG pLKO_005 1265 CDS 100% 10.800 8.640 N IKZF1 n/a
3 TRCN0000107870 GCTATCAATCATTAAGGTCAT pLKO.1 2803 3UTR 100% 4.050 3.240 N IKZF1 n/a
4 TRCN0000236420 GCATTTGGAAACGGGAATAAA pLKO_005 3439 3UTR 100% 15.000 10.500 N IKZF1 n/a
5 TRCN0000107872 CCGTTGGTAAACCTCACAAAT pLKO.1 340 CDS 100% 13.200 9.240 N IKZF1 n/a
6 TRCN0000236422 CTACGAGAAGGAGAACGAAAT pLKO_005 617 CDS 100% 10.800 7.560 N IKZF1 n/a
7 TRCN0000107873 GCCGAAGCTATAAACAGCGAA pLKO.1 373 CDS 100% 2.640 1.848 N IKZF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001220767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11482 pDONR223 100% 73.2% 73.2% None 159_160ins261;328_453del;559_560ins30 n/a
2 ccsbBroad304_11482 pLX_304 0% 73.2% 73.2% V5 159_160ins261;328_453del;559_560ins30 n/a
3 TRCN0000479864 CTGCACAGGTGAAGTGAGACAATT pLX_317 16.8% 73.2% 73.2% V5 159_160ins261;328_453del;559_560ins30 n/a
Download CSV