Transcript: Human NM_001227.5

Homo sapiens caspase 7 (CASP7), transcript variant a, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
CASP7 (840)
Length:
2344
CDS:
68..979

Additional Resources:

NCBI RefSeq record:
NM_001227.5
NBCI Gene record:
CASP7 (840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001227.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320946 TTTGACGTGATTGTCTATAAT pLKO_005 383 CDS 100% 15.000 21.000 N CASP7 n/a
2 TRCN0000320874 AGCTGGGCAAATGCATCATAA pLKO_005 264 CDS 100% 13.200 9.240 N CASP7 n/a
3 TRCN0000003519 AGGATTTGACAGCCCACTTTA pLKO.1 546 CDS 100% 13.200 9.240 N CASP7 n/a
4 TRCN0000350297 GCTTCGCCTGCATCCTCTTAA pLKO_005 474 CDS 100% 13.200 9.240 N CASP7 n/a
5 TRCN0000320872 GTATGTCTGTTACCTTGTTAA pLKO_005 1220 3UTR 100% 13.200 9.240 N CASP7 n/a
6 TRCN0000320945 TACTTCAGTCAATAGCCATAT pLKO_005 965 CDS 100% 10.800 7.560 N CASP7 n/a
7 TRCN0000003523 GTAATCACTAATGCTCAACAA pLKO.1 1991 3UTR 100% 4.950 3.465 N CASP7 n/a
8 TRCN0000003522 GCTGACTTCCTCTTCGCCTAT pLKO.1 716 CDS 100% 4.050 2.835 N CASP7 n/a
9 TRCN0000003520 CCTCGTTTGTACCGTCCCTCT pLKO.1 153 CDS 100% 0.720 0.504 N CASP7 n/a
10 TRCN0000003521 GCCTGCATCCTCTTAAGCCAT pLKO.1 479 CDS 100% 2.640 1.584 N CASP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001227.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05937 pDONR223 100% 99.8% 99.6% None 12T>G n/a
2 ccsbBroad304_05937 pLX_304 55.4% 99.8% 99.6% V5 12T>G n/a
3 TRCN0000473436 TATCCTTAAGGATGAAGAATGATT pLX_317 53.7% 99.8% 99.6% V5 12T>G n/a
Download CSV