Transcript: Human NM_001242336.2

Homo sapiens microfibril associated protein 3 (MFAP3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
MFAP3 (4238)
Length:
5334
CDS:
509..1597

Additional Resources:

NCBI RefSeq record:
NM_001242336.2
NBCI Gene record:
MFAP3 (4238)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116516 GCAAATCGTAGTTCTTACAAT pLKO.1 611 CDS 100% 5.625 7.875 N MFAP3 n/a
2 TRCN0000290351 GCAAATCGTAGTTCTTACAAT pLKO_005 611 CDS 100% 5.625 7.875 N MFAP3 n/a
3 TRCN0000116514 CTCGCCAAAGTCACACAATTT pLKO.1 1157 CDS 100% 13.200 10.560 N MFAP3 n/a
4 TRCN0000374964 TGATGACCGTGGGCTCTATAC pLKO_005 856 CDS 100% 10.800 7.560 N Mfap3 n/a
5 TRCN0000116512 CCTGTTTCTTAGAAGAAGTAA pLKO.1 1652 3UTR 100% 5.625 3.938 N MFAP3 n/a
6 TRCN0000290282 CCTGTTTCTTAGAAGAAGTAA pLKO_005 1652 3UTR 100% 5.625 3.938 N MFAP3 n/a
7 TRCN0000116515 GCCTTTGTTGAGGAGATGTTT pLKO.1 1256 CDS 100% 5.625 3.938 N MFAP3 n/a
8 TRCN0000290281 GCCTTTGTTGAGGAGATGTTT pLKO_005 1256 CDS 100% 5.625 3.938 N MFAP3 n/a
9 TRCN0000116513 GCTCGCCAAAGTCACACAATT pLKO.1 1156 CDS 100% 13.200 7.920 N MFAP3 n/a
10 TRCN0000290352 GCTCGCCAAAGTCACACAATT pLKO_005 1156 CDS 100% 13.200 7.920 N MFAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06577 pDONR223 100% 99.7% 100% None 177T>C;549T>C;786C>T n/a
2 ccsbBroad304_06577 pLX_304 62.2% 99.7% 100% V5 177T>C;549T>C;786C>T n/a
3 TRCN0000475301 CCCCCGATGGTGTATTTCTAAGGC pLX_317 33.7% 99.7% 100% V5 177T>C;549T>C;786C>T n/a
Download CSV