Transcript: Mouse NM_001242360.1

Mus musculus tRNA nucleotidyl transferase, CCA-adding, 1 (Trnt1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Trnt1 (70047)
Length:
1916
CDS:
81..728

Additional Resources:

NCBI RefSeq record:
NM_001242360.1
NBCI Gene record:
Trnt1 (70047)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001242360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111517 GCGATACCTGTTTACAATGAA pLKO.1 152 CDS 100% 5.625 7.875 N Trnt1 n/a
2 TRCN0000327142 GCGATACCTGTTTACAATGAA pLKO_005 152 CDS 100% 5.625 7.875 N Trnt1 n/a
3 TRCN0000111516 CGAATTGATGTTACCACTGAT pLKO.1 456 CDS 100% 4.950 3.960 N Trnt1 n/a
4 TRCN0000306527 ACGAAGAGATCTCACTATAAA pLKO_005 527 CDS 100% 15.000 10.500 N Trnt1 n/a
5 TRCN0000306528 TCAATGGTTATGCAGATTTAA pLKO_005 589 CDS 100% 15.000 10.500 N Trnt1 n/a
6 TRCN0000377070 AGGTGTAGTTGGAGTAGATTG pLKO_005 120 CDS 100% 10.800 7.560 N Trnt1 n/a
7 TRCN0000111518 GCCTGACAGAATTATTTGCCA pLKO.1 220 CDS 100% 0.750 0.450 N Trnt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11949 pDONR223 100% 37.1% 39.8% None (many diffs) n/a
2 ccsbBroad304_11949 pLX_304 0% 37.1% 39.8% V5 (many diffs) n/a
3 TRCN0000473813 CGTTCAGAAAACATGCATAGCTCT pLX_317 40.9% 37.1% 39.8% V5 (many diffs) n/a
Download CSV