Transcript: Mouse NM_001242407.1

Mus musculus mitoguardin 2 (Miga2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Miga2 (108958)
Length:
3394
CDS:
214..1995

Additional Resources:

NCBI RefSeq record:
NM_001242407.1
NBCI Gene record:
Miga2 (108958)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001242407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264550 GATCTTGAGAGGACCCTAATG pLKO_005 1000 CDS 100% 10.800 15.120 N Miga2 n/a
2 TRCN0000283079 CTAGTAGCATCGGGCTGAATG pLKO_005 1931 CDS 100% 0.000 0.000 N Miga2 n/a
3 TRCN0000183641 GTCTTGACATTCCATTCATTT pLKO.1 3176 3UTR 100% 13.200 9.240 N Miga2 n/a
4 TRCN0000264549 GTCTTGACATTCCATTCATTT pLKO_005 3176 3UTR 100% 13.200 9.240 N Miga2 n/a
5 TRCN0000283081 CTCCGTATCGGAGCATGTTAG pLKO_005 1701 CDS 100% 10.800 7.560 N Miga2 n/a
6 TRCN0000283080 CTCGATGGTAGTGGTCAATTC pLKO_005 630 CDS 100% 10.800 7.560 N Miga2 n/a
7 TRCN0000179638 GCTTTCTTCAAGCACCAGATT pLKO.1 1777 CDS 100% 4.950 3.465 N Miga2 n/a
8 TRCN0000172389 CTGATGGCTTCATCTCCCATT pLKO.1 1676 CDS 100% 4.050 2.835 N MIGA2 n/a
9 TRCN0000184604 GCAAGAGCAACGACACTCTTA pLKO.1 554 CDS 100% 0.495 0.347 N Miga2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12873 pDONR223 100% 32% 34.2% None (many diffs) n/a
2 ccsbBroad304_12873 pLX_304 0% 32% 34.2% V5 (many diffs) n/a
Download CSV