Transcript: Human NM_001242474.1

Homo sapiens zinc finger protein 345 (ZNF345), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
ZNF345 (25850)
Length:
3110
CDS:
360..1826

Additional Resources:

NCBI RefSeq record:
NM_001242474.1
NBCI Gene record:
ZNF345 (25850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016729 GCAAACCTTGCTTACCATCAA pLKO.1 666 CDS 100% 4.950 6.930 N ZNF345 n/a
2 TRCN0000435295 GACTATTTGATGGTAAGTTAC pLKO_005 2297 3UTR 100% 10.800 8.640 N ZNF345 n/a
3 TRCN0000016728 CTCTGCGAATTGGAAACTATA pLKO.1 1800 CDS 100% 13.200 9.240 N ZNF345 n/a
4 TRCN0000419841 TAGTAGTGGTTCAGCTCTTAA pLKO_005 1580 CDS 100% 13.200 9.240 N ZNF345 n/a
5 TRCN0000417080 CTTATCCAACACCAGCTAATC pLKO_005 1512 CDS 100% 10.800 7.560 N ZNF345 n/a
6 TRCN0000420327 GACATGCCCACTTTCAGTATC pLKO_005 489 CDS 100% 10.800 7.560 N ZNF345 n/a
7 TRCN0000431346 GATCTCAGGAAGGACATTTCA pLKO_005 445 CDS 100% 5.625 3.938 N ZNF345 n/a
8 TRCN0000436262 AGTGGTTCAAACCTTACTCAA pLKO_005 996 CDS 100% 4.950 3.465 N ZNF345 n/a
9 TRCN0000418786 GAACTGTGGGAAGGCTTATGG pLKO_005 1730 CDS 100% 4.950 3.465 N ZNF345 n/a
10 TRCN0000016732 GATTCAGAGTTTCAGCAACAT pLKO.1 1755 CDS 100% 4.950 3.465 N ZNF345 n/a
11 TRCN0000413398 GTAGTGGTTCAGACCTTACTC pLKO_005 1414 CDS 100% 4.950 3.465 N ZNF345 n/a
12 TRCN0000430069 AGGTACAAATGCCTTACTTAT pLKO_005 1906 3UTR 100% 13.200 7.920 N ZNF345 n/a
13 TRCN0000016731 GCGGATTCATACTGGTGAGAA pLKO.1 1022 CDS 100% 4.950 2.970 N ZNF345 n/a
14 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1369 CDS 100% 5.625 2.813 Y ZNF345 n/a
15 TRCN0000152004 CTGGTGAGAAACCTTATGAAT pLKO.1 613 CDS 100% 5.625 2.813 Y ZNF829 n/a
16 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1464 CDS 100% 4.950 2.475 Y ZNF829 n/a
17 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1465 CDS 100% 5.625 2.813 Y ZNF570 n/a
18 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 546 CDS 100% 4.050 2.025 Y ZNF700 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02871 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02871 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471616 TGTTAAAATTCTCAGCTCTTGACC pLX_317 30.5% 100% 100% V5 n/a
Download CSV