Transcript: Human NM_001242830.1

Homo sapiens ELOVL fatty acid elongase 5 (ELOVL5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ELOVL5 (60481)
Length:
2913
CDS:
372..1160

Additional Resources:

NCBI RefSeq record:
NM_001242830.1
NBCI Gene record:
ELOVL5 (60481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151739 CTACATTCAGACCTACAACAA pLKO.1 993 CDS 100% 4.950 6.930 N ELOVL5 n/a
2 TRCN0000343473 CTACATTCAGACCTACAACAA pLKO_005 993 CDS 100% 4.950 6.930 N ELOVL5 n/a
3 TRCN0000150504 GTACTACTTCTCCAAACTCAT pLKO.1 716 CDS 100% 4.950 6.930 N ELOVL5 n/a
4 TRCN0000343425 GTACTACTTCTCCAAACTCAT pLKO_005 716 CDS 100% 4.950 6.930 N ELOVL5 n/a
5 TRCN0000153717 CGCAGGAGAATCAGATATGAA pLKO.1 674 CDS 100% 5.625 4.500 N ELOVL5 n/a
6 TRCN0000151740 CACATTTATCTGCTCTGTCAT pLKO.1 473 CDS 100% 4.950 3.465 N ELOVL5 n/a
7 TRCN0000343471 CACATTTATCTGCTCTGTCAT pLKO_005 473 CDS 100% 4.950 3.465 N ELOVL5 n/a
8 TRCN0000153285 GAACATCTGGTGGTTTGTGAT pLKO.1 824 CDS 100% 4.950 3.465 N ELOVL5 n/a
9 TRCN0000153284 GATTTCCCTGATTGCTCTCTT pLKO.1 963 CDS 100% 4.950 3.465 N ELOVL5 n/a
10 TRCN0000343426 GATTTCCCTGATTGCTCTCTT pLKO_005 963 CDS 100% 4.950 3.465 N ELOVL5 n/a
11 TRCN0000153829 CCACATTTATCTGCTCTGTCA pLKO.1 472 CDS 100% 2.640 1.848 N ELOVL5 n/a
12 TRCN0000156642 GAATGGACACACCAACAGCTT pLKO.1 1077 CDS 100% 2.640 1.848 N ELOVL5 n/a
13 TRCN0000156864 GATGCTGAACATCTGGTGGTT pLKO.1 818 CDS 100% 2.640 1.848 N ELOVL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03885 pDONR223 100% 84.7% 50% None 496_497ins125;773_786del n/a
2 TRCN0000465403 TCTTATTACGTTTGTAATGTCAAA pLX_317 34.6% 84.7% 50% V5 496_497ins125;773_786del n/a
Download CSV