Transcript: Human NM_001242892.2

Homo sapiens cold shock domain containing E1 (CSDE1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CSDE1 (7812)
Length:
3710
CDS:
61..2457

Additional Resources:

NCBI RefSeq record:
NM_001242892.2
NBCI Gene record:
CSDE1 (7812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369330 CACTAATGAAGCCCGAGAAAT pLKO_005 1089 CDS 100% 13.200 18.480 N CSDE1 n/a
2 TRCN0000369331 CTGTAAGTGCTCGCAACATTA pLKO_005 569 CDS 100% 13.200 18.480 N CSDE1 n/a
3 TRCN0000047672 CGATATGAAAGGTGAGGTCTA pLKO.1 1935 CDS 100% 4.050 5.670 N CSDE1 n/a
4 TRCN0000047668 CGGTTTCATTTCATTCCCATT pLKO.1 1310 CDS 100% 4.050 5.670 N CSDE1 n/a
5 TRCN0000364598 TAGAGCGAGCAACCAATATAG pLKO_005 1043 CDS 100% 13.200 10.560 N CSDE1 n/a
6 TRCN0000364597 GTTAACCTCTTACGGATTTAT pLKO_005 159 CDS 100% 15.000 10.500 N CSDE1 n/a
7 TRCN0000369329 TGCAACAGATGTCAGACTATT pLKO_005 783 CDS 100% 13.200 9.240 N CSDE1 n/a
8 TRCN0000364674 TGGCGCCTTATAGTATCAATT pLKO_005 2683 3UTR 100% 13.200 9.240 N CSDE1 n/a
9 TRCN0000047670 CCAATATAGAAGTTCTGTCAA pLKO.1 1055 CDS 100% 4.950 3.465 N CSDE1 n/a
10 TRCN0000181610 GCAGAAAGAAAGATCCGTCAA pLKO.1 2419 CDS 100% 4.050 2.835 N Csde1 n/a
11 TRCN0000276865 GCAGAAAGAAAGATCCGTCAA pLKO_005 2419 CDS 100% 4.050 2.835 N Csde1 n/a
12 TRCN0000181609 GACCAGATAACTCAATGGGAT pLKO.1 2393 CDS 100% 2.640 3.696 N Csde1 n/a
13 TRCN0000319938 GACCAGATAACTCAATGGGAT pLKO_005 2393 CDS 100% 2.640 3.696 N Csde1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.