Transcript: Human NM_001242926.2

Homo sapiens zinc finger protein 410 (ZNF410), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF410 (57862)
Length:
2482
CDS:
207..1502

Additional Resources:

NCBI RefSeq record:
NM_001242926.2
NBCI Gene record:
ZNF410 (57862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219861 GAAGGTTGTGACCGGACATTT pLKO.1 876 CDS 100% 13.200 18.480 N ZNF410 n/a
2 TRCN0000148674 CACCTCAAGACTCATCGAAAT pLKO.1 921 CDS 100% 10.800 15.120 N ZNF410 n/a
3 TRCN0000148511 CGGCTAATGTTACCAGATGAT pLKO.1 360 CDS 100% 4.950 6.930 N ZNF410 n/a
4 TRCN0000148346 CCACAACAGAACCAGAATGAA pLKO.1 1578 3UTR 100% 5.625 3.938 N ZNF410 n/a
5 TRCN0000149441 GCTGAGCACTTAGTGTTTGTA pLKO.1 609 CDS 100% 5.625 3.938 N ZNF410 n/a
6 TRCN0000148193 GCAACTCTATCTGATCTCAAA pLKO.1 1527 3UTR 100% 4.950 3.465 N ZNF410 n/a
7 TRCN0000148632 CCACTGCAAATTTCTGGGATA pLKO.1 1749 3UTR 100% 4.050 2.835 N ZNF410 n/a
8 TRCN0000147787 GTTTGTTCAGAATACGTCCAT pLKO.1 251 CDS 100% 2.640 1.848 N ZNF410 n/a
9 TRCN0000149142 GCCAAGTGATAGCACTTCTTT pLKO.1 548 CDS 100% 0.563 0.394 N ZNF410 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12410 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12410 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480749 GACCTGTCAGATCCTCCCCACGTC pLX_317 29.1% 100% 100% V5 n/a
Download CSV