Transcript: Human NM_001243036.2

Homo sapiens solute carrier family 7 member 9 (SLC7A9), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SLC7A9 (11136)
Length:
1775
CDS:
203..1666

Additional Resources:

NCBI RefSeq record:
NM_001243036.2
NBCI Gene record:
SLC7A9 (11136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422037 TCAAGGTGCCCGTAGTCATTC pLKO_005 1422 CDS 100% 10.800 15.120 N SLC7A9 n/a
2 TRCN0000420839 CTCTACTGTGTGCTGTTTATA pLKO_005 1514 CDS 100% 15.000 10.500 N SLC7A9 n/a
3 TRCN0000419693 TGTTTGTCCACTACAAGTTTG pLKO_005 1560 CDS 100% 10.800 7.560 N SLC7A9 n/a
4 TRCN0000043082 GCCTATGATGGATGGAATCAA pLKO.1 893 CDS 100% 5.625 3.938 N SLC7A9 n/a
5 TRCN0000043079 CCATGCACCTTCAGATGCTAA pLKO.1 1611 CDS 100% 4.950 3.465 N SLC7A9 n/a
6 TRCN0000043078 CCTGGTGACATAAACTCGTTA pLKO.1 1304 CDS 100% 4.950 3.465 N SLC7A9 n/a
7 TRCN0000043080 CCCTTACAGAAACCTGCCTTT pLKO.1 943 CDS 100% 4.050 2.835 N SLC7A9 n/a
8 TRCN0000043081 CGTGATGAGATTTACAAGGAA pLKO.1 1384 CDS 100% 3.000 2.100 N SLC7A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02625 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02625 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480861 AGTCCTACGGTTGTGAATCTGCTC pLX_317 33.2% 100% 100% V5 n/a
Download CSV