Transcript: Mouse NM_001243047.1

Mus musculus discs, large homolog 2 (Drosophila) (Dlg2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dlg2 (23859)
Length:
5933
CDS:
300..1304

Additional Resources:

NCBI RefSeq record:
NM_001243047.1
NBCI Gene record:
Dlg2 (23859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024872 CCCATGAAGGATCGAATCAAT pLKO.1 753 CDS 100% 5.625 7.875 N Dlg2 n/a
2 TRCN0000361588 TAATTGGTACACTTCGAATTT pLKO_005 1703 3UTR 100% 13.200 9.240 N Dlg2 n/a
3 TRCN0000024871 CCTGGTGTGATTGATTCCAAA pLKO.1 600 CDS 100% 4.950 3.465 N Dlg2 n/a
4 TRCN0000006106 GAAGAGCATTTAGAAGAACAA pLKO.1 1333 3UTR 100% 4.950 3.465 N DLG2 n/a
5 TRCN0000137887 CCTCACTGAAACCTGTGCTTT pLKO.1 5306 3UTR 100% 4.950 3.465 N DLG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.