Transcript: Mouse NM_001243132.1

Mus musculus tetraspanin 2 (Tspan2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tspan2 (70747)
Length:
4066
CDS:
45..698

Additional Resources:

NCBI RefSeq record:
NM_001243132.1
NBCI Gene record:
Tspan2 (70747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094469 CCCGTTTGAAACTATGGAGAT pLKO.1 2842 3UTR 100% 4.050 5.670 N Tspan2 n/a
2 TRCN0000326866 CCCGTTTGAAACTATGGAGAT pLKO_005 2842 3UTR 100% 4.050 5.670 N Tspan2 n/a
3 TRCN0000094471 CCACTGGAGTATTTGCATTTA pLKO.1 343 CDS 100% 13.200 9.240 N Tspan2 n/a
4 TRCN0000326864 CCACTGGAGTATTTGCATTTA pLKO_005 343 CDS 100% 13.200 9.240 N Tspan2 n/a
5 TRCN0000094473 CTCACGATCTTTGGCATGATA pLKO.1 627 CDS 100% 5.625 3.938 N Tspan2 n/a
6 TRCN0000326800 CTCACGATCTTTGGCATGATA pLKO_005 627 CDS 100% 5.625 3.938 N Tspan2 n/a
7 TRCN0000094472 CCGTTATTGCATTTGGACTAT pLKO.1 115 CDS 100% 4.950 3.465 N Tspan2 n/a
8 TRCN0000326867 CCGTTATTGCATTTGGACTAT pLKO_005 115 CDS 100% 4.950 3.465 N Tspan2 n/a
9 TRCN0000094470 CCTGATGATGACTGTGGGTTT pLKO.1 233 CDS 100% 4.050 2.835 N Tspan2 n/a
10 TRCN0000354222 CCTGATGATGACTGTGGGTTT pLKO_005 233 CDS 100% 4.050 2.835 N Tspan2 n/a
11 TRCN0000157069 GCTGAAGTAACCACTGGAGTA pLKO.1 333 CDS 100% 4.050 2.835 N TSPAN2 n/a
12 TRCN0000152007 CTTTGGCATGATATTCAGCAT pLKO.1 635 CDS 100% 2.640 1.848 N TSPAN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07550 pDONR223 100% 83.2% 81.3% None (many diffs) n/a
2 ccsbBroad304_07550 pLX_304 0% 83.2% 81.3% V5 (many diffs) n/a
3 TRCN0000470782 ACATAGAGCGTCCCGCTCTGTTAA pLX_317 69.1% 83.2% 81.3% V5 (many diffs) n/a
Download CSV