Transcript: Human NM_001243157.1

Homo sapiens TATA-box binding protein associated factor, RNA polymerase I subunit C (TAF1C), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TAF1C (9013)
Length:
3518
CDS:
795..2408

Additional Resources:

NCBI RefSeq record:
NM_001243157.1
NBCI Gene record:
TAF1C (9013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013324 GCCGTGTGGAAGTTTGGTAAA pLKO.1 747 5UTR 100% 10.800 15.120 N TAF1C n/a
2 TRCN0000423863 TGATGATGAGCCAAGCAATTT pLKO_005 2528 3UTR 100% 13.200 9.240 N TAF1C n/a
3 TRCN0000013325 CTACTCTTCATCTCGTCTGTA pLKO.1 1159 CDS 100% 4.950 3.465 N TAF1C n/a
4 TRCN0000013323 CTGATGACATAGTAAGAGAAA pLKO.1 3327 3UTR 100% 4.950 3.465 N TAF1C n/a
5 TRCN0000413828 GCAGATGCTCCGTGACTACAT pLKO_005 2234 CDS 100% 4.950 3.465 N TAF1C n/a
6 TRCN0000421618 TGGATGTGACTGAGCAGATCA pLKO_005 252 5UTR 100% 4.950 3.465 N TAF1C n/a
7 TRCN0000416320 GCATTTCCAAGAGGTCGTTCT pLKO_005 596 5UTR 100% 4.050 2.835 N TAF1C n/a
8 TRCN0000013327 CTCTTGGATCATGGAGACGTA pLKO.1 281 5UTR 100% 2.640 1.848 N TAF1C n/a
9 TRCN0000426694 GTGAAGATGCTGGACACTCAG pLKO_005 1020 CDS 100% 4.050 2.430 N TAF1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07336 pDONR223 100% 68.9% 68.9% None (many diffs) n/a
2 ccsbBroad304_07336 pLX_304 0% 68.9% 68.9% V5 (many diffs) n/a
3 TRCN0000470147 AACCGAGCGATGCGCTATAGTTGC pLX_317 6.4% 68.9% 68.9% V5 (many diffs) n/a
Download CSV