Transcript: Human NM_001243211.2

Homo sapiens interleukin 18 (IL18), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
IL18 (3606)
Length:
1103
CDS:
198..767

Additional Resources:

NCBI RefSeq record:
NM_001243211.2
NBCI Gene record:
IL18 (3606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058745 GATACTTTCTAGCTTGTGAAA pLKO.1 658 CDS 100% 4.950 3.960 N IL18 n/a
2 TRCN0000058744 CCCGGACCATATTTATTATAA pLKO.1 421 CDS 100% 15.000 10.500 N IL18 n/a
3 TRCN0000435501 TGATTCTGACTGTAGAGATAA pLKO_005 395 CDS 100% 13.200 9.240 N IL18 n/a
4 TRCN0000058743 CCTCCTGATAACATCAAGGAT pLKO.1 555 CDS 100% 3.000 2.100 N IL18 n/a
5 TRCN0000058746 CAAGTTCTCTTCATTGACCAA pLKO.1 345 CDS 100% 2.640 1.848 N IL18 n/a
6 TRCN0000421404 TGGCAAGCTTGAATCTAAATT pLKO_005 299 CDS 100% 15.000 9.000 N IL18 n/a
7 TRCN0000058747 CCCAGGACATGATAATAAGAT pLKO.1 611 CDS 100% 5.625 3.375 N IL18 n/a
8 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 869 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06448 pDONR223 100% 97.7% 97.9% None 78_79insGCTGAAGATGAT;93A>C n/a
2 ccsbBroad304_06448 pLX_304 0% 97.7% 97.9% V5 78_79insGCTGAAGATGAT;93A>C n/a
3 TRCN0000472844 AGCTGTTCGACAAAGGCATCAAAG pLX_317 82.6% 97.7% 97.9% V5 78_79insGCTGAAGATGAT;93A>C n/a
Download CSV