Transcript: Human NM_001243281.1

Homo sapiens activated leukocyte cell adhesion molecule (ALCAM), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
ALCAM (214)
Length:
2961
CDS:
697..2364

Additional Resources:

NCBI RefSeq record:
NM_001243281.1
NBCI Gene record:
ALCAM (214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323152 CTTCGATCTAGCCCGTCATTT pLKO_005 1813 CDS 100% 13.200 18.480 N ALCAM n/a
2 TRCN0000156195 CGACTTGACGTACCTCAGAAT pLKO.1 826 CDS 100% 4.950 6.930 N ALCAM n/a
3 TRCN0000323149 CGACTTGACGTACCTCAGAAT pLKO_005 826 CDS 100% 4.950 6.930 N ALCAM n/a
4 TRCN0000152237 CGAAGGAATAAGAAGCTCAAA pLKO.1 1563 CDS 100% 4.950 3.465 N ALCAM n/a
5 TRCN0000323150 CGAAGGAATAAGAAGCTCAAA pLKO_005 1563 CDS 100% 4.950 3.465 N ALCAM n/a
6 TRCN0000196189 GCAGGAATGCAACTGTGGTAT pLKO.1 1772 CDS 100% 4.950 3.465 N ALCAM n/a
7 TRCN0000178950 CCGAAGGAATAAGAAGCTCAA pLKO.1 1562 CDS 100% 4.050 2.835 N ALCAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05800 pDONR223 100% 95% 95.1% None 900G>A;1266G>A;1665_1666ins84 n/a
2 ccsbBroad304_05800 pLX_304 0% 95% 95.1% V5 900G>A;1266G>A;1665_1666ins84 n/a
3 TRCN0000475983 CTCTTTATGTTCTAATTAATGAAG pLX_317 18.6% 95% 95.1% V5 900G>A;1266G>A;1665_1666ins84 n/a
Download CSV