Transcript: Human NM_001243386.1

Homo sapiens parvin beta (PARVB), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PARVB (29780)
Length:
1554
CDS:
118..987

Additional Resources:

NCBI RefSeq record:
NM_001243386.1
NBCI Gene record:
PARVB (29780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122961 CAGTCCGAAATAGGGCAGAAA pLKO.1 379 CDS 100% 4.950 6.930 N PARVB n/a
2 TRCN0000343679 CAGTCCGAAATAGGGCAGAAA pLKO_005 379 CDS 100% 4.950 6.930 N PARVB n/a
3 TRCN0000122960 CGTGGTTAACTTGGACCTCAA pLKO.1 912 CDS 100% 4.050 5.670 N PARVB n/a
4 TRCN0000343681 CGTGGTTAACTTGGACCTCAA pLKO_005 912 CDS 100% 4.050 5.670 N PARVB n/a
5 TRCN0000122962 CCTGTTCACCAAGTACAAGAA pLKO.1 957 CDS 100% 4.950 3.960 N PARVB n/a
6 TRCN0000343621 CCTGTTCACCAAGTACAAGAA pLKO_005 957 CDS 100% 4.950 3.960 N PARVB n/a
7 TRCN0000122959 CCAAGCTGTGTTGACTGTCAT pLKO.1 1089 3UTR 100% 4.950 3.465 N PARVB n/a
8 TRCN0000343682 CCAAGCTGTGTTGACTGTCAT pLKO_005 1089 3UTR 100% 4.950 3.465 N PARVB n/a
9 TRCN0000122963 CTTCGATCAGAAGGTCCACAA pLKO.1 825 CDS 100% 4.050 2.835 N PARVB n/a
10 TRCN0000343680 CTTCGATCAGAAGGTCCACAA pLKO_005 825 CDS 100% 4.050 2.835 N PARVB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.