Transcript: Human NM_001243729.1

Homo sapiens solute carrier family 66 member 1 like (SLC66A1L), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
SLC66A1L (152078)
Length:
1020
CDS:
195..413

Additional Resources:

NCBI RefSeq record:
NM_001243729.1
NBCI Gene record:
SLC66A1L (152078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263982 ATAGGTGGAGACCTGACAAAT pLKO_005 348 CDS 100% 13.200 9.240 N SLC66A1L n/a
2 TRCN0000263981 TAGCTAATGCTATAGTCATTT pLKO_005 703 3UTR 100% 13.200 9.240 N SLC66A1L n/a
3 TRCN0000263980 TCTACGGAAGGAACTTCATTT pLKO_005 420 3UTR 100% 13.200 9.240 N SLC66A1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05062 pDONR223 100% 61% 60.1% None 213_214insATTTTTACAGCCATC;216_217ins123 n/a
2 ccsbBroad304_05062 pLX_304 0% 61% 60.1% V5 213_214insATTTTTACAGCCATC;216_217ins123 n/a
3 TRCN0000466474 GGTTATCGTATTAGTCCACTGGGC pLX_317 100% 61% 60.1% V5 213_214insATTTTTACAGCCATC;216_217ins123 n/a
Download CSV