Transcript: Human NM_001243759.2

Homo sapiens ubiquitin specific peptidase 2 (USP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
USP2 (9099)
Length:
2882
CDS:
174..1262

Additional Resources:

NCBI RefSeq record:
NM_001243759.2
NBCI Gene record:
USP2 (9099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007277 CCGCGCTTTGTTGGCTATAAT pLKO.1 486 CDS 100% 15.000 21.000 N USP2 n/a
2 TRCN0000007279 CCCATTGCTAAGCGAGGTTAT pLKO.1 774 CDS 100% 10.800 15.120 N USP2 n/a
3 TRCN0000011080 CCTCGGCGTTTGCATTTGTAA pLKO.1 1502 3UTR 100% 5.625 7.875 N USP2 n/a
4 TRCN0000427947 CCTAAGAGACCTGGACTTAAG pLKO_005 1010 CDS 100% 10.800 8.640 N USP2 n/a
5 TRCN0000433402 ATGAGCCAAGAGCCCTCTTCA pLKO_005 1721 3UTR 100% 4.950 3.960 N USP2 n/a
6 TRCN0000424107 CACTCGGGAGTTGAGAGATTA pLKO_005 305 CDS 100% 13.200 9.240 N USP2 n/a
7 TRCN0000433549 ACAGACGAAGGGACATCTTTG pLKO_005 1760 3UTR 100% 10.800 7.560 N USP2 n/a
8 TRCN0000429730 ACAGGAGAATGGCACACTTTC pLKO_005 1143 CDS 100% 10.800 7.560 N USP2 n/a
9 TRCN0000428225 TGGTCTTCCTATGTGTCAGAA pLKO_005 1528 3UTR 100% 4.950 3.465 N USP2 n/a
10 TRCN0000415688 ACAACACACAAACCTGACAAG pLKO_005 1347 3UTR 100% 4.050 2.835 N USP2 n/a
11 TRCN0000007280 CCATGCTGTTTACAACCTGTA pLKO.1 1055 CDS 100% 4.050 2.835 N USP2 n/a
12 TRCN0000007278 GCTCACAACATTTGTGAACTT pLKO.1 986 CDS 100% 0.495 0.347 N USP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489958 ATCTGTATCTTTTCAGCGCTCCAT pLX_317 25.8% 58.7% 58.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488149 TATCCGTTTGACCTACCCCGACCG pLX_317 14% 58.7% 58% V5 (many diffs) n/a
Download CSV