Construct: ORF TRCN0000488149
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019921.1_s317c1
- DNA Barcode:
- TATCCGTTTGACCTACCCCGACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP2 (9099)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488149
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9099 | USP2 | ubiquitin specific peptidase 2 | NM_004205.5 | 99.8% | 99.8% | 96G>A;1038C>T;1815_1816insG |
2 | human | 9099 | USP2 | ubiquitin specific peptidase 2 | XM_005271721.5 | 99.8% | 99.8% | 96G>A;1038C>T;1815_1816insG |
3 | human | 9099 | USP2 | ubiquitin specific peptidase 2 | XM_005271722.2 | 99.8% | 99.8% | 96G>A;1038C>T;1815_1816insG |
4 | human | 9099 | USP2 | ubiquitin specific peptidase 2 | NM_171997.3 | 63.3% | 58.4% | (many diffs) |
5 | human | 9099 | USP2 | ubiquitin specific peptidase 2 | NM_001243759.2 | 58.7% | 58% | (many diffs) |
6 | human | 9099 | USP2 | ubiquitin specific peptidase 2 | XM_017018539.1 | 57.9% | 57.5% | (many diffs) |
7 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | NM_016808.2 | 85.8% | 87.9% | (many diffs) |
8 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | NM_198092.2 | 85.8% | 87.9% | (many diffs) |
9 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_006510480.1 | 85.8% | 87.9% | (many diffs) |
10 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313461.1 | 82.1% | 83.9% | (many diffs) |
11 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313462.1 | 82.1% | 83.9% | (many diffs) |
12 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313463.1 | 82.1% | 83.9% | (many diffs) |
13 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313464.1 | 82.1% | 83.9% | (many diffs) |
14 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313465.1 | 82.1% | 83.9% | (many diffs) |
15 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313466.1 | 82.1% | 83.9% | (many diffs) |
16 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | NM_198091.2 | 57% | 55.9% | (many diffs) |
17 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313467.1 | 54.5% | 53.4% | (many diffs) |
18 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_011242577.2 | 51.8% | 54.9% | (many diffs) |
19 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313468.1 | 49.6% | 52.4% | (many diffs) |
20 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313469.1 | 49.6% | 52.4% | (many diffs) |
21 | mouse | 53376 | Usp2 | ubiquitin specific peptidase 2 | XM_017313470.1 | 49.6% | 52.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1887
- ORF length:
- 1818
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gtcccagctc tcctccaccc tgaagcgcta cacagaatcg gcccgctaca 121 cagatgccca ctatgccaag tcgggctatg gtgcctacac cccatcctcc tatggggcca 181 atctggctgc ctccttactg gagaaggaga aacttggttt caagccggtc cccaccagca 241 gcttcctcac ccgtccccgt acctatggcc cctcctccct cctggactat gaccggggcc 301 gccccctgct gagacccgac atcactgggg gtggtaagcg ggcagagagc cagacccggg 361 gtactgagcg gcctttaggc agtggcctca gcgggggcag cggattccct tatggagtga 421 ccaacaactg cctcagctac ctgcccatca atgcctatga ccagggggtg accctaaccc 481 agaagctgga cagccaatca gacctggccc gggatttctc cagcctccgg acctcagata 541 gctaccggat agaccccagg aacctgggcc gcagccccat gctggcccgg acgcgcaagg 601 agctctgcac cctgcagggg ctctaccaga cagccagctg ccctgaatac ctggtcgact 661 acctggagaa ctatggtcgc aagggcagtg catctcaggt gccctcccag gcccctccct 721 cacgagtccc tgaaatcatc agcccaacct accgacccat tggccgctac acgctgtggg 781 agacgggaaa gggtcaggcc cctgggccca gccgctccag ctccccggga agagacggca 841 tgaattctaa gagtgcccag ggtctggctg gtcttcgaaa ccttgggaac acgtgcttca 901 tgaactcaat tctgcagtgc ctgagcaaca ctcgggagtt gagagattac tgcctccaga 961 ggctctacat gcgggacctg caccacggca gcaatgcaca cacagccctc gtggaagagt 1021 ttgcaaaact aattcagacc atatggactt catcccccaa tgatgtggtg agcccatctg 1081 agttcaagac ccagatccag agatatgcac cgcgctttgt tggctataat cagcaggatg 1141 ctcaggagtt ccttcgcttt cttctggatg ggctccataa cgaggtgaac cgagtgacac 1201 tgagacctaa gtccaaccct gagaacctcg atcatcttcc tgatgacgag aaaggccgac 1261 agatgtggag aaaatatcta gaacgggaag acagtaggat cggggatctc tttgttgggc 1321 agctaaagag ctcgctgacg tgtacagatt gtggttactg ttctacggtc ttcgacccct 1381 tctgggacct ctcactgccc attgctaagc gaggttatcc tgaggtgaca ttaatggact 1441 gcatgaggct cttcaccaaa gaggatgtgc ttgatggaga tgaaaagcca acatgctgtc 1501 gctgccgagg cagaaaacgg tgtataaaga agttctccat ccagaggttc ccaaagatct 1561 tggtgctcca tctgaagcgg ttctcagaat ccaggatccg aaccagcaag ctcacaacat 1621 ttgtgaactt cccccTAAGA GACCTGGACT TAAGAGAATT TGCCTCAGAA AACACCAACC 1681 ATGCTGTTTA CAACCTGTAC GCTGTGTCCA ATCACTCCGG AACCACCATG GGTGGCCACT 1741 ATACAGCCTA CTGTCGCAGT CCAGGGACAG GAGAATGGCA CACTTTCAAC GACTCCAGCG 1801 TCACTCCCAT GTCCTCCAGC CAAGTGCGCA CCAGCGACGC CTACCTGCTC TTCTACGAAC 1861 TGGCCAGCCC GCCCTCCCGA ATGGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1921 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1981 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT ATCCGTTTGA 2041 CCTACCCCGA CCGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2101 att