Transcript: Mouse NM_001243761.2

Mus musculus class II transactivator (Ciita), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ciita (12265)
Length:
5167
CDS:
42..3269

Additional Resources:

NCBI RefSeq record:
NM_001243761.2
NBCI Gene record:
Ciita (12265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086448 GCCGAACTATAATAACTTGAA pLKO.1 4088 3UTR 100% 4.950 6.930 N Ciita n/a
2 TRCN0000086449 GCTACAATATGACTTTGTCTT pLKO.1 1202 CDS 100% 4.950 3.960 N Ciita n/a
3 TRCN0000086452 CCCAGCTACCTTGTACACTTA pLKO.1 1768 CDS 100% 4.950 3.465 N Ciita n/a
4 TRCN0000086450 GCAGAGGAGAAGTTCACCATT pLKO.1 2607 CDS 100% 4.950 3.465 N Ciita n/a
5 TRCN0000086451 CAAGACTTACATGAGGCACTA pLKO.1 1598 CDS 100% 4.050 2.835 N Ciita n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.