Transcript: Human NM_001243797.1

Homo sapiens TSC22 domain family member 1 (TSC22D1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TSC22D1 (8848)
Length:
2872
CDS:
129..389

Additional Resources:

NCBI RefSeq record:
NM_001243797.1
NBCI Gene record:
TSC22D1 (8848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013291 GCAAGCTATGGATCTAGTGAA pLKO.1 122 5UTR 100% 4.950 6.930 N TSC22D1 n/a
2 TRCN0000329929 GAGCAAATCAAAGAACTAATA pLKO_005 189 CDS 100% 13.200 9.240 N TSC22D1 n/a
3 TRCN0000329852 GGTGCAAGTGTGGTAGCTATT pLKO_005 87 5UTR 100% 10.800 7.560 N TSC22D1 n/a
4 TRCN0000013288 GCCTCTTTCTTCTCAAACAAT pLKO.1 926 3UTR 100% 5.625 3.938 N TSC22D1 n/a
5 TRCN0000329850 GCCTCTTTCTTCTCAAACAAT pLKO_005 926 3UTR 100% 5.625 3.938 N TSC22D1 n/a
6 TRCN0000013292 GTCCTCAAAGAGCAAATCAAA pLKO.1 180 CDS 100% 5.625 3.938 N TSC22D1 n/a
7 TRCN0000013289 GCAGGAGAACAATCTGCTGAA pLKO.1 230 CDS 100% 4.050 2.835 N TSC22D1 n/a
8 TRCN0000374229 GGTGCAAGTGTGGTAGCTATC pLKO_005 87 5UTR 100% 6.000 4.200 N Tsc22d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02032 pDONR223 100% 59.7% 59.7% None 0_1ins174 n/a
2 ccsbBroad304_02032 pLX_304 0% 59.7% 59.7% V5 0_1ins174 n/a
Download CSV