Transcript: Human NM_001243892.2

Homo sapiens TPD52 like 2 (TPD52L2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
TPD52L2 (7165)
Length:
2181
CDS:
97..588

Additional Resources:

NCBI RefSeq record:
NM_001243892.2
NBCI Gene record:
TPD52L2 (7165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166604 CCCTGTCTTTAGCACCCTTTA pLKO.1 1530 3UTR 100% 10.800 15.120 N TPD52L2 n/a
2 TRCN0000280926 CCCTGTCTTTAGCACCCTTTA pLKO_005 1530 3UTR 100% 10.800 15.120 N TPD52L2 n/a
3 TRCN0000159392 GACCATAAAGTCTAAGGTTGT pLKO.1 483 CDS 100% 4.050 5.670 N TPD52L2 n/a
4 TRCN0000280922 GACCATAAAGTCTAAGGTTGT pLKO_005 483 CDS 100% 4.050 5.670 N TPD52L2 n/a
5 TRCN0000161679 GCGGAGGGTTTGAAAGAATAT pLKO.1 852 3UTR 100% 13.200 10.560 N TPD52L2 n/a
6 TRCN0000280857 GCGGAGGGTTTGAAAGAATAT pLKO_005 852 3UTR 100% 13.200 10.560 N TPD52L2 n/a
7 TRCN0000166214 CTTGGAGACATGAGGAACTCT pLKO.1 430 CDS 100% 3.000 2.100 N TPD52L2 n/a
8 TRCN0000280924 CTTGGAGACATGAGGAACTCT pLKO_005 430 CDS 100% 3.000 2.100 N TPD52L2 n/a
9 TRCN0000166346 CTTACCAAGGTGGAAGAGGAA pLKO.1 184 CDS 100% 2.640 1.848 N TPD52L2 n/a
10 TRCN0000166528 CAGGAAACTCTTTCACAGGCA pLKO.1 355 CDS 100% 0.660 0.396 N TPD52L2 n/a
11 TRCN0000280925 CAGGAAACTCTTTCACAGGCA pLKO_005 355 CDS 100% 0.660 0.396 N TPD52L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01699 pDONR223 100% 79.1% 79.1% None 17_18ins69;245_246ins60 n/a
2 ccsbBroad304_01699 pLX_304 0% 79.1% 79.1% V5 17_18ins69;245_246ins60 n/a
3 TRCN0000473459 ACACTAGGGGAACCTCTCCGGAAC pLX_317 79.9% 79.1% 79.1% V5 17_18ins69;245_246ins60 n/a
Download CSV