Transcript: Human NM_001243940.1

Homo sapiens phosphoribosyl pyrophosphate synthetase associated protein 2 (PRPSAP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PRPSAP2 (5636)
Length:
1680
CDS:
129..1091

Additional Resources:

NCBI RefSeq record:
NM_001243940.1
NBCI Gene record:
PRPSAP2 (5636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045469 CCCATGCTGATTCCTAAAGAA pLKO.1 858 CDS 100% 5.625 3.938 N PRPSAP2 n/a
2 TRCN0000315750 CCCATGCTGATTCCTAAAGAA pLKO_005 858 CDS 100% 5.625 3.938 N PRPSAP2 n/a
3 TRCN0000045470 GCAGGTTTACCAGGAACCTAA pLKO.1 275 CDS 100% 0.495 0.347 N PRPSAP2 n/a
4 TRCN0000045472 ACCAAGATGAACATAACCAAA pLKO.1 159 CDS 100% 4.950 2.970 N PRPSAP2 n/a
5 TRCN0000315751 ACCAAGATGAACATAACCAAA pLKO_005 159 CDS 100% 4.950 2.970 N PRPSAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01300 pDONR223 100% 86.7% 86.7% None 803_804ins147 n/a
2 TRCN0000479876 ACGGCGACACATCCAGGGGTGCCG pLX_317 33.1% 86.7% 86.7% V5 803_804ins147 n/a
Download CSV