Construct: ORF TRCN0000479876
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004371.1_s317c1
- Derived from:
- ccsbBroadEn_01300
- DNA Barcode:
- ACGGCGACACATCCAGGGGTGCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRPSAP2 (5636)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479876
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353101.2 | 100% | 100% | |
2 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353102.2 | 100% | 100% | |
3 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353105.2 | 100% | 100% | |
4 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353106.2 | 100% | 100% | |
5 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353107.2 | 100% | 100% | |
6 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_002767.4 | 100% | 100% | |
7 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XM_017024865.2 | 100% | 100% | |
8 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XM_017024866.2 | 100% | 100% | |
9 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001243936.2 | 89.1% | 89.1% | 118_119ins120 |
10 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353096.1 | 87.8% | 87.8% | 0_1ins135 |
11 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353097.2 | 87.8% | 87.8% | 0_1ins135 |
12 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353099.2 | 87.8% | 87.8% | 0_1ins135 |
13 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353098.2 | 87.2% | 87.2% | 1_162del |
14 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001243940.1 | 86.7% | 86.7% | 803_804ins147 |
15 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001243941.1 | 76.6% | 76.6% | 0_1ins258 |
16 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001243942.1 | 76.6% | 76.6% | 0_1ins258 |
17 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353100.2 | 76.6% | 76.6% | 0_1ins258 |
18 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353103.2 | 76.6% | 76.6% | 0_1ins258 |
19 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | NM_001353104.2 | 76.6% | 76.6% | 0_1ins258 |
20 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XM_017024871.2 | 76.6% | 76.6% | 0_1ins258 |
21 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XM_017024873.2 | 76.6% | 76.6% | 0_1ins258 |
22 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XM_017024874.2 | 76.6% | 76.6% | 0_1ins258 |
23 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XM_017024875.2 | 76.6% | 76.6% | 0_1ins258 |
24 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XR_934068.2 | 61.4% | 1_210del;944_1041del;1177_1178ins238 | |
25 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XR_001752567.2 | 54.8% | 1_210del;943_944ins71;1247_1819del | |
26 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XR_001752568.2 | 54.3% | 1_259del;993_1090del;1465_2037del | |
27 | human | 5636 | PRPSAP2 | phosphoribosyl pyrophosphat... | XR_001752569.2 | 53.4% | 1_259del;992_993ins71;1296_1868del | |
28 | mouse | 212627 | Prpsap2 | phosphoribosyl pyrophosphat... | NM_001164242.1 | 90.7% | 98.9% | (many diffs) |
29 | mouse | 212627 | Prpsap2 | phosphoribosyl pyrophosphat... | NM_144806.2 | 90.7% | 98.9% | (many diffs) |
30 | mouse | 212627 | Prpsap2 | phosphoribosyl pyrophosphat... | XM_006532761.3 | 90.7% | 98.9% | (many diffs) |
31 | mouse | 212627 | Prpsap2 | phosphoribosyl pyrophosphat... | XM_017314418.1 | 71% | 77.7% | (many diffs) |
32 | mouse | 212627 | Prpsap2 | phosphoribosyl pyrophosphat... | XM_017314419.1 | 71% | 77.7% | (many diffs) |
33 | mouse | 212627 | Prpsap2 | phosphoribosyl pyrophosphat... | NM_001164243.1 | 69.2% | 76.1% | (many diffs) |
34 | mouse | 212627 | Prpsap2 | phosphoribosyl pyrophosphat... | NM_001164244.1 | 69.2% | 76.1% | (many diffs) |
35 | mouse | 212627 | Prpsap2 | phosphoribosyl pyrophosphat... | XM_017314420.1 | 69.2% | 76.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1176
- ORF length:
- 1107
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gttttgtgtg acgccacctg aattagaaac caagatgaac ataaccaaag 121 gtggtctggt gttgttttca gcaaactcga attcatcatg tatggagcta tcaaagaaaa 181 ttgcagagcg gctaggggtg gagatgggca aagtgcaggt ttaccaggaa cctaacagag 241 aaacaagagt acaaattcaa gagtctgtga ggggaaaaga tgttttcatc atccaaactg 301 tttcgaagga cgtgaacacc accatcatgg agctcctgat catggtgtat gcatgtaaga 361 cctcttgtgc caagagcatc attggcgtga taccctactt tccttacagc aagcagtgca 421 agatgagaaa aagaggctcc attgtctcta aattgctggc ttccatgatg tgcaaagctg 481 gtctaactca tcttattact atggatttac accagaagga aattcagggc ttcttcaata 541 ttcctgttga caatttaaga gcatctccct tcttattaca gtatattcaa gaagagatcc 601 cagattacag gaatgcagta atcgtggcca agtctccagc ctcggcgaag agggcacagt 661 cttttgctga gcgcctgcgc ctgggaattg cagtgattca tggagaggcg caggatgccg 721 agtcggactt ggtggatgga cggcattccc cacccatggt cagaagtgtg gctgccatcc 781 accccagcct ggagatcccc atgctgattc cTAAAGAAAA GCCCCCAATC ACGGTTGTGG 841 GTGATGTTGG AGGAAGGATT GCCATCATCG TGGATGACAT CATTGATGAT GTTGACAGCT 901 TTCTTGCTGC AGCAGAGACC CTGAAGGAAA GAGGTGCATA TAAGATCTTT GTGATGGCAA 961 CTCATGGCTT GTTGTCTTCT GACGCCCCCC GGCGGATTGA AGAGTCTGCC ATTGATGAGG 1021 TGGTGGTCAC CAATACAATT CCACATGAAG TCCAGAAGCT CCAGTGCCCC AAGATTAAAA 1081 CTGTGGATAT CAGCATGATC CTTTCAGAGG CGATCCGTCG GATCCACAAT GGGGAGTCCA 1141 TGTCCTACCT TTTCAGAAAC ATAGGCTTAG ATGACTTGCC AACTTTCTTG TACAAAGTGG 1201 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1261 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1321 AACGGCGACA CATCCAGGGG TGCCGACGCG TTAAGTCgac aatcaacctc tggattacaa 1381 aatttgtgaa agatt