Transcript: Human NM_001243941.1

Homo sapiens phosphoribosyl pyrophosphate synthetase associated protein 2 (PRPSAP2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PRPSAP2 (5636)
Length:
1872
CDS:
432..1283

Additional Resources:

NCBI RefSeq record:
NM_001243941.1
NBCI Gene record:
PRPSAP2 (5636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045471 CCTGAAGGAAAGAGGTGCATA pLKO.1 1025 CDS 100% 4.950 6.930 N PRPSAP2 n/a
2 TRCN0000315748 CCTGAAGGAAAGAGGTGCATA pLKO_005 1025 CDS 100% 4.950 6.930 N PRPSAP2 n/a
3 TRCN0000045469 CCCATGCTGATTCCTAAAGAA pLKO.1 903 CDS 100% 5.625 3.938 N PRPSAP2 n/a
4 TRCN0000315750 CCCATGCTGATTCCTAAAGAA pLKO_005 903 CDS 100% 5.625 3.938 N PRPSAP2 n/a
5 TRCN0000045468 CGGATTGAAGAGTCTGCCATT pLKO.1 1098 CDS 100% 4.050 2.835 N PRPSAP2 n/a
6 TRCN0000315749 CGGATTGAAGAGTCTGCCATT pLKO_005 1098 CDS 100% 4.050 2.835 N PRPSAP2 n/a
7 TRCN0000045472 ACCAAGATGAACATAACCAAA pLKO.1 257 5UTR 100% 4.950 2.970 N PRPSAP2 n/a
8 TRCN0000315751 ACCAAGATGAACATAACCAAA pLKO_005 257 5UTR 100% 4.950 2.970 N PRPSAP2 n/a
9 TRCN0000078827 CCCTGAAGGAAAGAGGTGCAT pLKO.1 1024 CDS 100% 2.640 1.584 N Gm13651 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01300 pDONR223 100% 76.6% 76.6% None 0_1ins258 n/a
2 TRCN0000479876 ACGGCGACACATCCAGGGGTGCCG pLX_317 33.1% 76.6% 76.6% V5 0_1ins258 n/a
Download CSV