Transcript: Mouse NM_001243943.1

Mus musculus B cell translocation gene 1, anti-proliferative, pseudogene 1 (Btg1-ps1), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Btg1-ps1 (436199)
Length:
825
CDS:
340..825

Additional Resources:

NCBI RefSeq record:
NM_001243943.1
NBCI Gene record:
Btg1-ps1 (436199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087901 CGCATCAACCATAAGATGGAT pLKO.1 520 CDS 100% 3.000 1.500 Y Btg1-ps2 n/a
2 TRCN0000007625 CACTACAAACACCACTGGTTT pLKO.1 460 CDS 100% 4.950 2.475 Y BTG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00179 pDONR223 100% 81.7% 80.1% None (many diffs) n/a
2 ccsbBroad304_00179 pLX_304 98.3% 81.7% 80.1% V5 (many diffs) n/a
3 TRCN0000475091 CTTGGACATTTAAAAGATAACAGT pLX_317 48.5% 81.5% 80.1% V5 (many diffs) n/a
Download CSV