Transcript: Human NM_001244666.2

Homo sapiens syntaxin 5 (STX5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
STX5 (6811)
Length:
1832
CDS:
118..1083

Additional Resources:

NCBI RefSeq record:
NM_001244666.2
NBCI Gene record:
STX5 (6811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218714 CAAGTCCCTCTTTGATGATAA pLKO_005 480 CDS 100% 13.200 18.480 N STX5 n/a
2 TRCN0000059824 GCAGTCGAAACTGGCTTCTAT pLKO.1 654 CDS 100% 5.625 7.875 N STX5 n/a
3 TRCN0000059827 GCAGAACATTGAGTCGACAAT pLKO.1 936 CDS 100% 4.950 3.960 N STX5 n/a
4 TRCN0000230315 GAATGGAATCCAGACAAATAA pLKO_005 342 CDS 100% 15.000 10.500 N STX5 n/a
5 TRCN0000230317 CAGAACATTGAGTCGACAATT pLKO_005 937 CDS 100% 13.200 9.240 N STX5 n/a
6 TRCN0000230316 GAAATTGAAGAGCTAACATAT pLKO_005 508 CDS 100% 13.200 9.240 N STX5 n/a
7 TRCN0000230318 TTGGGAGAAAGGCCCTGTTTC pLKO_005 1314 3UTR 100% 10.800 7.560 N STX5 n/a
8 TRCN0000059823 CCAGACAAATAAGCCAGCTTT pLKO.1 351 CDS 100% 4.950 3.465 N STX5 n/a
9 TRCN0000059826 CCTTAGCAACACATTTGCCAA pLKO.1 429 CDS 100% 2.640 1.848 N STX5 n/a
10 TRCN0000059825 CCATTCAGAGATCCTCAAGTA pLKO.1 1109 3UTR 100% 4.950 2.970 N STX5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11167 pDONR223 100% 83.1% 83.1% None 1_162del n/a
2 ccsbBroad304_11167 pLX_304 0% 83.1% 83.1% V5 1_162del n/a
3 TRCN0000491829 AGATTACTTACAATGTCCTTTATT pLX_317 47.8% 83.1% 83.1% V5 1_162del n/a
4 ccsbBroadEn_11166 pDONR223 100% 69.1% 70.4% None 1_162del;907_944del;963_964ins140 n/a
5 ccsbBroad304_11166 pLX_304 0% 69.1% 70.4% V5 1_162del;907_944del;963_964ins140 n/a
6 TRCN0000470119 TTAACGCCGAACCTCCTCTATGAC pLX_317 51.4% 69.1% 70.4% V5 1_162del;907_944del;963_964ins140 n/a
Download CSV