Transcript: Mouse NM_001251833.1

Mus musculus zinc finger with KRAB and SCAN domains 8 (Zkscan8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Zkscan8 (93681)
Length:
8584
CDS:
254..1804

Additional Resources:

NCBI RefSeq record:
NM_001251833.1
NBCI Gene record:
Zkscan8 (93681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001251833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217953 ACACAAGAGAGACGACATAAA pLKO_005 1016 CDS 100% 13.200 9.240 N ZKSCAN8 n/a
2 TRCN0000095901 GACGACATAAATGTGATGAAT pLKO.1 1026 CDS 100% 5.625 3.938 N Zkscan8 n/a
3 TRCN0000095899 CATTAGAGAAACCATGTACTA pLKO.1 1839 3UTR 100% 4.950 3.465 N Zkscan8 n/a
4 TRCN0000095900 CCTCCAAGTATTCACGTACAA pLKO.1 743 CDS 100% 4.950 3.465 N Zkscan8 n/a
5 TRCN0000095902 CCTGAAGAGGATCTTGTCATT pLKO.1 308 CDS 100% 4.950 3.465 N Zkscan8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01816 pDONR223 100% 77.7% 77.2% None (many diffs) n/a
2 ccsbBroad304_01816 pLX_304 0% 77.7% 77.2% V5 (many diffs) n/a
3 TRCN0000477419 CGGGCTCGAAACTTATCCGTGGAC pLX_317 22.7% 77.7% 77.2% V5 (many diffs) n/a
4 ccsbBroadEn_07171 pDONR223 100% 77.7% 77.2% None (many diffs) n/a
5 ccsbBroad304_07171 pLX_304 0% 77.7% 77.2% V5 (many diffs) n/a
6 TRCN0000473447 CCGAGAACCACTAAGGGCTCACAT pLX_317 31.3% 77.7% 77.2% V5 (many diffs) n/a
Download CSV