Transcript: Human NM_001251974.1

Homo sapiens regulator of calcineurin 2 (RCAN2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-14
Taxon:
Homo sapiens (human)
Gene:
RCAN2 (10231)
Length:
3316
CDS:
154..885

Additional Resources:

NCBI RefSeq record:
NM_001251974.1
NBCI Gene record:
RCAN2 (10231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418121 GGACTGTTTCGGACTTATGAT pLKO_005 391 CDS 100% 5.625 4.500 N RCAN2 n/a
2 TRCN0000147843 GCCACTTAAATAGGACCATAT pLKO.1 1261 3UTR 100% 10.800 7.560 N RCAN2 n/a
3 TRCN0000181084 CGAGCTAGGATAGAGCTTCAT pLKO.1 487 CDS 100% 4.950 3.465 N RCAN2 n/a
4 TRCN0000147659 GTCCGTATAAACTTCAGCAAT pLKO.1 451 CDS 100% 4.950 3.465 N RCAN2 n/a
5 TRCN0000180292 CCTCAACTATGACCTCCTCTA pLKO.1 681 CDS 100% 4.050 2.835 N RCAN2 n/a
6 TRCN0000180812 GAGTTTCAGACGTGTCCGTAT pLKO.1 438 CDS 100% 4.050 2.835 N RCAN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07572 pDONR223 100% 67.9% 63.4% None (many diffs) n/a
2 ccsbBroad304_07572 pLX_304 0% 67.9% 63.4% V5 (many diffs) n/a
3 TRCN0000468641 CGCCGGCGATTATGGAGGTGAATC pLX_317 71.9% 67.9% 63.4% V5 (many diffs) n/a
Download CSV