Transcript: Mouse NM_001252071.1

Mus musculus gene regulated by estrogen in breast cancer protein (Greb1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Greb1 (268527)
Length:
7868
CDS:
309..6089

Additional Resources:

NCBI RefSeq record:
NM_001252071.1
NBCI Gene record:
Greb1 (268527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262702 CTATCTTGAAGTCCGTTATAT pLKO_005 6323 3UTR 100% 15.000 21.000 N Greb1 n/a
2 TRCN0000282386 TACTGTGACCTGCGTCTAATA pLKO_005 3366 CDS 100% 13.200 10.560 N Greb1 n/a
3 TRCN0000282384 TCTGGCCCTTCATCGTCATTG pLKO_005 5149 CDS 100% 10.800 8.640 N Greb1 n/a
4 TRCN0000281560 AGTACGAAATGGCCATTTATA pLKO_005 4972 CDS 100% 15.000 10.500 N Greb1 n/a
5 TRCN0000216019 CTACTTTGTTAGCAATGATAT pLKO.1 3440 CDS 100% 13.200 9.240 N Greb1 n/a
6 TRCN0000282387 CTACTTTGTTAGCAATGATAT pLKO_005 3440 CDS 100% 13.200 9.240 N Greb1 n/a
7 TRCN0000191125 CGTTATATGCAGAATGAAGTT pLKO.1 6336 3UTR 100% 4.950 3.465 N Greb1 n/a
8 TRCN0000192688 GCTGGAGAAATTCCTCCAATA pLKO.1 5678 CDS 100% 1.080 0.756 N Greb1 n/a
9 TRCN0000200523 CCAGTGATATTTAAAGGCCAT pLKO.1 1461 CDS 100% 2.160 1.296 N Greb1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7088 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.