Transcript: Human NM_001252093.1

Homo sapiens muscle RAS oncogene homolog (MRAS), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-19
Taxon:
Homo sapiens (human)
Gene:
MRAS (22808)
Length:
3822
CDS:
138..536

Additional Resources:

NCBI RefSeq record:
NM_001252093.1
NBCI Gene record:
MRAS (22808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001252093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036990 CAAACTGCAATGTGTGATCTT pLKO.1 512 CDS 100% 4.950 6.930 N MRAS n/a
2 TRCN0000420695 TCTCGGTGGGTGTGTTGTTTA pLKO_005 820 3UTR 100% 13.200 10.560 N MRAS n/a
3 TRCN0000418490 GACAAGGAAGCCACCTGTAAG pLKO_005 735 3UTR 100% 10.800 8.640 N MRAS n/a
4 TRCN0000036992 GTACATAGAAACCAGTGCCAA pLKO.1 362 CDS 100% 2.640 2.112 N MRAS n/a
5 TRCN0000429539 TGGAAGTGTTTATCCACATAC pLKO_005 868 3UTR 100% 10.800 7.560 N MRAS n/a
6 TRCN0000036989 CCACCTCTCAATGTCGACAAA pLKO.1 387 CDS 100% 4.950 3.465 N MRAS n/a
7 TRCN0000036993 GCGTCAAAGACAGGGAGTCAT pLKO.1 244 CDS 100% 4.950 3.465 N MRAS n/a
8 TRCN0000431835 GGATGGCTTCCTCATCGTCTA pLKO_005 164 CDS 100% 4.050 2.835 N MRAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11628 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11628 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480722 GGCTCACCTTACCTAACTACGGAG pLX_317 100% 100% 100% V5 n/a
Download CSV